Search Search

BenchMark Special Stains system

Empowering Special Stains with consistent quality, workflow efficiency and improved safety through automated slide staining and ready-to-use reagents.

IVD For in vitro diagnostic use.
Product image for BenchMark Special Stains instrument

The BenchMark Special Stains system enhances workflow with proven technology

Benchmark Special Stains
speech-bubble

Contact Roche

Contact a Roche representative. Do you have questions about our products or services? We're here to help! Contact us today.

Form Successfully Submitted!
Thank you for your submission!
text
close
Contact us

The BenchMark Special Stains system offers a new level of automation for Special Stains.

Productivity features such as the ability to run any test next to any other test and waste fluid sensing optimize workflow. Reducing manual processes and improving lab capabilities allows your skilled laboratory professionals to focus on higher value contributions.

Additionally, an intuitive user interface (Ventana System Software) connects up to eight BenchMark Special Stains and IHC/ISH instruments, enabling seamless integration and easy adoption for lab personnel.

Related information

The BenchMark Special Stains system brings full automation to the anatomic pathology laboratory for Special Stains to enhance confidence with a more informed diagnosis.

Consistent quality

Optimize assays with customizable protocols and leverage automation to eliminate technician variability for reproducible, high quality stains. Jones Staining Kit images demonstrate customizable staining achieved with different protocol selections.

Special Stains slides

Enhanced workflow efficiency

  • Eliminate manual processes with ready-to-use reagents, fully automated baking, deparaffinization and staining, and independent slide heating
  • Slide carousel holds 1–20 slides with independent temperature control for each position
  • Free standing or modified benchtop installation
  • Bulk fluid and waste capacities designed to support a minimum of three full runs
BenchMark Special Stains instrument workflow image

Improved safety

  • Ready-to-use reagents reduce technician exposure to, and handling of, hazardous chemicals
  • Bulk fluid volume sensing automatically detects waste fluid levels to prevent spills or overflow
  • Barcoded slides and reagents ensure the right test for the right patient
  • Individual slide staining virtually eliminates cross-contamination
Roche BenchMark Special Stains instrument image for safety

Experience advanced support

CareGiver remote support establishes a communication link between the BenchMark Special Stains instrument and the Roche customer support center, delivering remote troubleshooting and training, software upgrades over the internet and over-the-shoulder help from Roche service experts.

Customer support

You might be interested in

...
    ...
    Contact us

    Overview

    Ordering Information

    Technical Documents

    Access Material Data Sheets, Certificates of Analysis, and other product documentation.

    After clicking below, you will be redirected to eLabDoc, where you can choose your local country.
    Document repository artboard

    General characteristics

    • Fully automated

      Baking, deparaffinization and staining of Special Stains

    • Slide carousel

      1–20 slides with independent temperature control for each position

    • Reagent carousel

      25 reagent positions

    • Slides

      25 mm x 75 mm or 26 mm x 76 mm Superfrost Plus

    • Bulk fluids

      Up to four bulk fluids in 3-6 L on-board containers

    • DI water quality specifications

      Clinical and Laboratory Standards Institute (CLSI) guideline C3-A4 Clinical Laboratory Reagent Water (CLRW)

    • Modularity

      1–8 BenchMark instruments may be controlled from one PC

    • Configuration

      Free standing or modified benchtop installation

    • Certifications

      CSA, EMC, CE compliant

    • Ordering code

      06657389001

    Temperature control

    • Instrument operational temperature

      37°C–75°C (98°F–167°F)

    Environmental requirements

    • Heat

      1200 BTU/Hr

    • Operating temperature

      15°C to 30°C (64°F to 90°F)

    • Humidity

      20% to 80%, non-condensing

    Electrical specifications

    • Voltage

      100 VAC +/- 10% (Japan), 120 VAC +/- 10% (US & Canada), 230 VAC +/- 10% (Europe)

    • Current

      4 Amps

    • Frequency

      50/60 Hz

    • Power connection

      Standard 3-prong grounded

    • Fuse

      Waste module: 6.3 Amps, 250 Volts, 5 mm x 20 mm, fast acting

    Instrument physical characteristics

    • Size (W x D x H)

      50.8 cm x 63 cm x 135.4 cm (20 in x 25 in x 53.3 in)

    • Weight

      76.7 kg (165.7 lbs)

    • Clearances

      Rear 15.2 cm (6 in)
      Top 30.5 cm (12 in)
      Left side 7.6 cm (3 in)
      Right side 61 cm (24 in) to open door to 90°
      Right side 101.6 cm (40 in) to open door to 180°
      Front 108 cm (42.5 in)
    IVD For in vitro diagnostic use.
    CONFIRM anti-Calretinin (SP65) Rabbit Monoclonal Primary Antibody
    CONFIRM anti-Calretinin (SP65) Rabbit Monoclonal Primary Antibody CONFIRM anti-Calretinin (SP65) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of calretinin by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA HER2 Dual ISH DNA Probe Cocktail Assay CDx icon
    VENTANA® HER2 Dual ISH DNA Probe Cocktail CE-IVD The VENTANA HER2 Dual ISH DNA Probe Cocktail assay is a fully automated, ready-to-use brightfield solution for determining HER2 gene status.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> Red ISH DIG Detection Kit
    VENTANA® Red ISH DIG Detection Kit The VENTANA Red ISH DIG Detection Kit is an indirect system for detecting DIG-labeled targets. The kit is intended to identify targets by chromogenic red in situ hybridization (ISH) in sections of formalin-fixed, paraffin-embedded tissue that are stained on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified reader in conjunction with histological examination, relevant clinical information, and proper controls.
    IVD For in vitro diagnostic use.
    VENTANA ALK (D5F3) CDx Assay
    VENTANA® ALK (D5F3) CDx Assay US-FDA The VENTANA ALK (D5F3) CDx Assay empowers your lab to provide timely results with a four-and-one-half hour run time using fully automated, ready-to-use reagents.
    IVD For in vitro diagnostic use.
    CONFIRM anti-Thyroid Transcription Factor-1 (8G7G3/1) Mouse Monoclonal Primary Antibody
    CONFIRM anti-Thyroid Transcription Factor-1 (8G7G3/1) Mouse Monoclonal Primary Antibody Factor-1 (8G7G3/1) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of thyroid transcription factor-1 (TTF-1) by light microscopy in sections of formalin-fixed paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and with proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-MUC1 (H23) Mouse Monoclonal Primary Antibody
    anti-MUC1 (H23) Mouse Monoclonal Primary Antibody Anti-MUC1 (H23) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of MUC1 by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA PD-L1 (SP263) Assay, non-small cell lung cancer (NSCLC), urothelial carcinoma, bladder cancer
    VENTANA® PD-L1 (SP263) Assay CE-IVD VENTANA PD-L1 (SP263) Assay is intended for the qualitative detection of the programmed death ligand 1 (PD-L1) protein in formalin-fixed, paraffin-embedded (FFPE) non-small cell lung cancer (NSCLC), urothelial carcinoma (UC) and other tumor tissues stained with OptiView DAB IHC Detection Kit on a BenchMark IHC/ISH instrument.
    IVD For in vitro diagnostic use.
    PD-L1 SP142 Assay
    VENTANA® PD-L1 (SP142) Assay CE-IVD VENTANA PD-L1 (SP142) Assay is intended for the immunohistochemical assessment of the programmed death-ligand 1 (PD-L1) protein in tumor cells and tumor infiltrating immune cells in formalin-fixed, paraffin-embedded (FFPE) tumor tissue stained with OptiView DAB IHC Detection Kit and OptiView Amplification Kit on a VENTANA BenchMark IHC/ISH instrument.
    IVD For in vitro diagnostic use.
    Smoothelin (R4A) Mouse Monoclonal Antibody
    Smoothelin (R4A) Mouse Monoclonal Antibody Smoothelin (R4A) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the Smoothelin protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-bcl-2 (124) Mouse Monoclonal Primary Antibody
    CONFIRM anti-bcl-2 (124) Mouse Monoclonal Primary Antibody CONFIRM anti-bcl-2 (124) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of B-cell lymphoma 2 protein (bcl-2) by light microscopy in sections of formalin-fixed, paraffin-embedded (FFPE) tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-Cytokeratin 10 (SP99) Rabbit Monoclonal Primary Antibody
    anti-Cytokeratin 10 (SP99) Rabbit Monoclonal Primary Antibody Anti-Cytokeratin 10 (SP99) Rabbit Monoclonal Primary Antibody (anti-Cytokeratin 10 (SP99)) is directed against the 56.5kD member of the type 1 cytokeratin family, cytokeratin 10. Cytokeratin 10 is expressed in keratinizing stratified epithelia, but is absent from the basal layer, in various organs including the skin. Anti-Cytokeratin 10 (SP99) exhibits a cytoplasmic staining pattern and may be used to aid in the identification of well differentiated squamous carcinomas of the cervix and anus. The antibody is intended for qualitative staining of sections of formalin-fixed, paraffin-embedded tissue.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-EGFR E746-A750 del (SP111) Rabbit Monoclonal Primary Antibody
    anti-EGFR E746-A750 del (SP111) Rabbit Monoclonal Primary Antibody Anti-EGFR E746-A750 del (SP111) Rabbit Monoclonal Primary Antibody (anti-EGFR E746-A750 del (SP111)) exhibits a cell membranous and/or cytoplasmic staining pattern and may be used to aid in the identification of the Epidermal Growth Factor Receptor mutant protein, EGFR E746-A750 del. The antibody is intended for qualitative staining in sections of formalin-fixed, paraffin-embedded tissue.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-EGFR L858R (SP125) Rabbit Monoclonal Primary Antibody
    anti-EGFR L858R (SP125) Rabbit Monoclonal Primary Antibody Anti-EGFR L858R (SP125) Rabbit Monoclonal Primary Antibody (anti-EGFR L858R (SP125)) exhibits a cell membranous and/or cytoplasmic staining pattern and may be used to aid in the identification of the Epidermal Growth Factor Receptor mutant protein, EGFR L858R. The antibody is intended for qualitative staining in sections of formalin-fixed, paraffin-embedded tissue.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-S100P (16/f5) Mouse Monoclonal Primary Antibody
    anti-S100P (16/f5) Mouse Monoclonal Primary Antibody S100P (16/f5) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the S100P protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-CD44 (SP37) Rabbit Monoclonal Primary Antibody
    anti-CD44 (SP37) Rabbit Monoclonal Primary Antibody Anti-CD44 (SP37) Rabbit Monoclonal Primary Antibody is directed against the CD44 protein. CD44 is a type I transmembrane receptor protein expressed in several cell types including T and B lymphocytes, monocytes, granulocytes, erythrocytes, fibroblasts, epithelial, and mast cells. This antibody exhibits a membraneous staining pattern and may be used to detect the CD44 standard and variant proteins in a variety of neoplastic tissues, including squamous cell and urothelial carcinoma. The antibody is intended for qualitative staining of sections of formalin-fixed, paraffin-embedded tissue.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Collagen Type IV (CIV22) Mouse Monoclonal Antibody
    Collagen Type IV (CIV22) Mouse Monoclonal Antibody Collagen Type IV (CIV22) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the Collagen Type IV protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Perforin (MRQ-23) Mouse Monoclonal Antibody
    Perforin (MRQ-23) Mouse Monoclonal Antibody Perforin (MRQ-23) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the perforin protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    bcl-6 (GI191E/A8) Mouse Monoclonal Antibody
    bcl-6 (GI191E/A8) Mouse Monoclonal Antibody bcl-6 (GI191E/A8) Mouse Monoclonal Antibody is intended for laboratory use in the detection of the bcl6 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Beta-Catenin (14) Mouse Monoclonal Antibody
    Beta-Catenin (14) Mouse Monoclonal Antibody Beta-Catenin (14) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the Beta-Catenin protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CD16 (SP175) Rabbit Monoclonal Primary Antibody
    CD16 (SP175) Rabbit Monoclonal Primary Antibody CD16 (SP175) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the CD16 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CD33 (SP266) Rabbit Monoclonal Primary Antibody
    CD33 (SP266) Rabbit Monoclonal Primary Antibody CD33 (SP266) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the CD33 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> ISH <i>i</i>VIEW<sub>Blue</sub> Detection Kit
    VENTANA® ISH iVIEWBlue Detection Kit VENTANA ISH iVIEW Blue Detection Kit is an indirect biotin streptavidin system for the detection of fluorescein-labeled probes. The kit is intended to identify targets by in situ hybridization in sections of formalin-fixed, paraffin-embedded tissue that are stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-PAX5 (SP34) Rabbit Monoclonal Primary Antibody
    CONFIRM anti-PAX5 (SP34) Rabbit Monoclonal Primary Antibody CONFIRM anti-PAX5 (SP34) Rabbit Monoclonal Primary Antibody is  intended for laboratory use in the qualitative immunohistochemical detection of PAX5 by light microscopy  in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> anti-p63 (4A4) Mouse Monoclonal Primary Antibody
    VENTANA® anti-p63 (4A4) Mouse Monoclonal Primary Antibody VENTANA anti-p63 (4A4) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of the p63 protein by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> anti-E-cadherin (36) Mouse Monoclonal Primary Antibody
    VENTANA® anti-E-cadherin (36) Mouse Monoclonal Primary Antibody VENTANA anti-E-cadherin (36) Mouse Monoclonal Primary Antibody is intended for laboratory use in qualitative immunohistochemical detection of E- cadherin by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CD61 (2f2) Mouse Monoclonal Antibody
    CD61 (2f2) Mouse Monoclonal Antibody CD61 (2f2) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the CD61 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-Chromogranin A (LK2H10) Primary Antibody
    anti-Chromogranin A (LK2H10) Primary Antibody Anti-Chromogranin A (LK2H10) Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of chromogranin A by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-CD4 (SP35) Rabbit Monoclonal Primary Antibody
    CONFIRM anti-CD4 (SP35) Rabbit Monoclonal Primary Antibody CONFIRM anti-CD4 (SP35) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of CD4 by light microscopy in sections of formalin-fixed, paraffin- embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-CD20 (L26) Primary Antibody
    CONFIRM anti-CD20 (L26) Primary Antibody CONFIRM anti-CD20 (L26) Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of CD20 by light microscopy in sections of formalin-fixed, paraffinembedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-CD15 (MMA) Mouse Monoclonal, Primary Antibody
    CONFIRM anti-CD15 (MMA) Mouse Monoclonal, Primary Antibody CONFIRM anti-CD15 (MMA) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of CD15 by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> anti-Cyclin D1 (SP4-R) Rabbit Monoclonal Primary Antibody
    VENTANA® anti-Cyclin D1 (SP4-R) Rabbit Monoclonal Primary Antibody VENTANA anti-Cyclin D1 (SP4-R) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of cyclin D1 by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-CD5 (SP19) Rabbit Monoclonal Primary Antibody
    CONFIRM anti-CD5 (SP19) Rabbit Monoclonal Primary Antibody CONFIRM anti-CD5 (SP19) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of CD5 by light microscopy in sections of formalin fixed, paraffin embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    TSH Rabbit Polyclonal Antibody
    TSH Rabbit Polyclonal Antibody TSH Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the TSH glycoprotein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> anti-BRAF V600E (VE1) Mouse Monoclonal Primary Antibody
    VENTANA® anti-BRAF V600E (VE1) Mouse Monoclonal Primary Antibody For use with VENTANA MMR IHC Panel, CE-IVD VENTANA anti-BRAF V600E (VE1) Mouse Monoclonal Primary Antibody (VENTANA anti-BRAF V600E (VE1) antibody) is intended for the qualitative detection of BRAF V600E protein in formalin-fixed, paraffin-embedded tissue sections. VENTANA anti-BRAF V600E (VE1) antibody is ready to use on BenchMark IHC/ISH instruments with the OptiView DAB IHC Detection Kit and ancillary reagents.VENTANA anti-BRAF V600E (VE1) antibody is part of the VENTANA MMR IHC Panel which includes VENTANA anti-MLH1 (M1) Mouse Monoclonal Primary Antibody, VENTANA anti-PMS2 (A16-4) Mouse Monoclonal Primary Antibody, VENTANA anti-MSH2 (G219-1129) Mouse Monoclonal Primary Antibody and VENTANA anti-MSH6 (SP93) Rabbit Monoclonal Primary Antibody. The VENTANA MMR IHC Panel is indicated for the detection of mismatch repair protein deficiency as a test for the identification of individuals at risk for Lynch syndrome in patients diagnosed with colorectal cancer (CRC), and, with BRAF V600E status, as an aid to differentiate between sporadic and probable Lynch syndrome CRC in the absence of MLH1 protein expression.These products should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.Intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> Basal Cell Cocktail (34βE12+p63)
    VENTANA® Basal Cell Cocktail (34βE12+p63) VENTANA Basal Cell Cocktail (34βE12+p63) is an antibody cocktail of anti-p63 (4A4) and anti-keratin (34βE12) mouse monoclonal antibodies. VENTANA Basal Cell Cocktail (34βE12+p63) is intended for laboratory use in the qualitative immunohistochemical detection of p63 and cytokeratin 5 in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> anti-BRAF V600E (VE1) Mouse Monoclonal Primary Antibody
    VENTANA® anti-BRAF V600E (VE1) Mouse Monoclonal Primary Antibody For use with VENTANA MMR IHC Panel, US-FDA
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> anti-CD10 (SP67) Rabbit Monoclonal Primary Antibody
    VENTANA® anti-CD10 (SP67) Rabbit Monoclonal Primary Antibody VENTANA anti-CD10 (SP67) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of CD10 by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> Silver ISH DNP Detection Kit
    VENTANA® Silver ISH DNP Detection Kit The VENTANA Silver ISH DNP Detection Kit is an indirect system for detecting DNP- labeled targets. The kit is intended to identify targets by silver in situ hybridization (ISH) in sections of formalin-fixed, paraffin-embedded tissue that are stained on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified reader in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    PSA (ER-PR8) Mouse Monoclonal Antibody
    PSA (ER-PR8) Mouse Monoclonal Antibody RUO Anti-PSA (ER-PR8) may be used as the primary antibody for immunohistochmical staining of formalin-fixed, paraffin-embedded tissue sections.
    IVD For in vitro diagnostic use.
    anti-p504s (SP116) Rabbit Monoclonal Primary Antibody
    anti-p504s (SP116) Rabbit Monoclonal Primary Antibody Anti-p504s (SP116) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of α-methylacyl-CoA racemase (AMACR, also known as p504s) by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-p40 (BC28) Mouse Monoclonal Primary Antibody
    anti-p40 (BC28) Mouse Monoclonal Primary Antibody Anti-p40 (BC28) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of the p40 protein by light microscopy in formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    PSMA (EP192) Rabbit Monoclonal Primary Antibody
    PSMA (EP192) Rabbit Monoclonal Primary Antibody PSMA (EP192) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the PSMA protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    HGAL (MRQ-49) Mouse Monoclonal Antibody
    HGAL (MRQ-49) Mouse Monoclonal Antibody HGAL (MRQ-49) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of HGAL in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Olig2 (EP112) Rabbit Monoclonal Primary Antibody
    Olig2 (EP112) Rabbit Monoclonal Primary Antibody Olig2 (EP112) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the Olig2 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-LMO2 (SP51) Rabbit Monoclonal Primary Antibody
    anti-LMO2 (SP51) Rabbit Monoclonal Primary Antibody anti-LMO2 (SP51) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the LMO2 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Melanoma Triple Cocktail (HMB45+A103+T311) Primary Antibody
    Melanoma Triple Cocktail (HMB45+A103+T311) Primary Antibody Melanoma Triple Cocktail (HMB45+A103+T311) is a cocktail of anti-Melanosome (HMB45), anti-MART1/melan A (A103), and anti-Tyrosinase (T311) mouse monoclonal antibodies. Melanoma Triple Cocktail (HMB45+A103+T311) is intended for laboratory use in the qualitative  immunohistochemical detection of premelanosome protein (PMEL), melan A, and tyrosinase by light microscopy in sections of formalin-fixed, paraffinembedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use. 
    IVD For in vitro diagnostic use.
    SALL4 (6E3) Mouse Monoclonal Antibody
    SALL4 (6E3) Mouse Monoclonal Antibody SALL4 (6E3) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the SALL4 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Cytokeratin 5 (SP27) Rabbit Monoclonal Primary Antibody
    Cytokeratin 5 (SP27) Rabbit Monoclonal Primary Antibody Cytokeratin 5 (SP27) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the Cytokeratin 5 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-Cytokeratin 5/6 (D5/16B4) Mouse Monoclonal Primary Antibody
    anti-Cytokeratin 5/6 (D5/16B4) Mouse Monoclonal Primary Antibody Anti-Cytokeratin 5/6 (D5/16B4) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of cytokeratin 5 by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Cadherin-17 (SP183) Rabbit Monoclonal Primary Antibody
    Cadherin-17 (SP183) Rabbit Monoclonal Primary Antibody Cadherin-17 (SP183) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the Cadherin-17 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CD13 (SP187) Rabbit Monoclonal Primary Antibody
    CD13 (SP187) Rabbit Monoclonal Primary Antibody CD13 (SP187) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the CD13 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-Cytokeratin 14 (SP53) Rabbit Monoclonal Primary Antibody
    anti-Cytokeratin 14 (SP53) Rabbit Monoclonal Primary Antibody Cytokeratin 14 (SP53) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the Cytokeratin 14 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Cytokeratin 5/14 (EP1601Y/LL002) Rabbit and Mouse Monoclonal Primary Antibody
    Cytokeratin 5/14 (EP1601Y/LL002) Rabbit and Mouse Monoclonal Primary Antibody Cytokeratin 5/14 (EP1601Y/LL002) Rabbit and Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the Cytokeratin 5 & 14 proteins in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    BCA-225 (Cu-18) Mouse Monoclonal Antibody
    BCA-225 (Cu-18) Mouse Monoclonal Antibody BCA-225 (Cu-18) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the BCA-225 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Granzyme B Rabbit Polyclonal Antibody
    Granzyme B Rabbit Polyclonal Antibody Granzyme B Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the Granzyme B protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-CD3 (2GV6) Rabbit Monoclonal Primary Antibody
    CONFIRM anti-CD3 (2GV6) Rabbit Monoclonal Primary Antibody CONFIRM anti-CD3 (2GV6) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of CD3 by light microscopy in sections of formalin-fixed, paraffin- embedded tissue stained on a BenchMark IHC/ISH instrumentsThis product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use. 
    IVD For in vitro diagnostic use.
    CD138/syndecan-1 (B-A38) Mouse Monoclonal Antibody
    CD138/syndecan-1 (B-A38) Mouse Monoclonal Antibody CD138/syndecan-1 (B-A38) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the CD138/syndecan-1 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Cytokeratin 8 &amp; 18 (B22.1 &amp; B23.1) Mouse Monoclonal Antibody
    Cytokeratin 8 & 18 (B22.1 & B23.1) Mouse Monoclonal Antibody Anti-Cytokeratin 8 & 18 (B22.1 & B23.1) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the cytokeratin 8 & 18 proteins in formalin-fixed, paraffinembedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Cytokeratin (35betaH11) Mouse Monoclonal Antibody
    Cytokeratin (35betaH11) Mouse Monoclonal Antibody Cytokeratin (35betaH11) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the cytokeratin 8 and 18 proteins in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Hepatocyte Specific Antigen (Hep Par-1) (OCH1E5) Mouse Monoclonal Antibody
    Hepatocyte Specific Antigen (Hep Par-1) (OCH1E5) Mouse Monoclonal Antibody Hepatocyte Specific Antigen (OCH1E5) Mouse Monoclonal Antibody is intended for laboratory use in the detection of mitochondrial antigen in hepatocytes in formalin-fixed, paraffinembedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    ISH Protease 1
    ISH Protease 1 ISH Protease 1 is intended for enzymatic digestion of formalin-fixed, paraffin-embedded tissue sections, or whole cell preparations on a BenchMark IHC/ISH instrument. This reagent removes protein that surrounds the target nucleic acid sequences of interest during in situ hybridization applications.This reagent is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Fascin (55k-2) Mouse Monoclonal Antibody
    Fascin (55k-2) Mouse Monoclonal Antibody Fascin (55k-2) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the fascin protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    FSH Rabbit Polyclonal Antibody
    FSH Rabbit Polyclonal Antibody FSH Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of FSH in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Glycophorin A (GA-R2) Mouse Monoclonal Antibody
    Glycophorin A (GA-R2) Mouse Monoclonal Antibody Glycophorin A (GA-R2) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the Glycophorin A protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    TAG-72 (B72.3) Mouse Monoclonal Antibody
    TAG-72 (B72.3) Mouse Monoclonal Antibody TAG-72 (B72.3) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the TAG-72 glycoprotein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Red Counterstain II
    Red Counterstain II Red Counterstain II is intended to aid microscopic bright field observation for in situ hybridization applications. Red Counterstain II is for use with formalin-fixed, paraffin-embedded tissue on a BenchMark IHC/ISH instrument.This reagent is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Myosin, Smooth Muscle (SMMS-1) Mouse Monoclonal Antibody
    Myosin, Smooth Muscle (SMMS-1) Mouse Monoclonal Antibody Myosin, Smooth Muscle (SMMS-1) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of Smooth Muscle Myosin heavy chain in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CD45R (MB1) Mouse Monoclonal Antibody
    CD45R (MB1) Mouse Monoclonal Antibody CD45R (MB1) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the CD45R protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Mesothelial Cell (HBME-1) Mouse Monoclonal Antibody
    Mesothelial Cell (HBME-1) Mouse Monoclonal Antibody Mesothelial Cell (HBME-1) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the HBME-1 protein in formalin-fixed, paraffin-embedded tissue stained on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    BG8, Lewis<sup>y</sup> (F3) Mouse Monoclonal Antibody
    BG8, Lewisy (F3) Mouse Monoclonal Antibody BG8, LewisY (F3) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of BG8 in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    C4d Rabbit Polyclonal Antibody
    C4d Rabbit Polyclonal Antibody C4d Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the C4d protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-Ki-67 (30-9) Rabbit Monoclonal Primary Antibody
    CONFIRM anti-Ki-67 (30-9) Rabbit Monoclonal Primary Antibody CONFIRM anti-Ki-67 (30-9) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of Ki-67 protein by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-Keratin (34βE12) Mouse Monoclonal Primary Antibody
    CONFIRM anti-Keratin (34βE12) Mouse Monoclonal Primary Antibody CONFIRM anti-Keratin (34βE12) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of cytokeratin 5 by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information and proper controls.This antibody is intended for in vitro diagnostic use.
    IVD For in vitro diagnostic use.
    PGP 9.5 Rabbit Polyclonal Antibody
    PGP 9.5 Rabbit Polyclonal Antibody PGP 9.5 Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the PGP9.5 (UCH-L1) enzyme in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Podoplanin (D2-40) Mouse Monoclonal Antibody
    Podoplanin (D2-40) Mouse Monoclonal Antibody Podoplanin (D2-40) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the Podoplanin glycoprotein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Human Placental Lactogen (hPL) Rabbit Polyclonal Antibody
    Human Placental Lactogen (hPL) Rabbit Polyclonal Antibody Human Placental Lactogen (hPL) Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the hPL protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Alcian Blue for PAS
    Alcian Blue for PAS Alcian Blue for PAS, in conjunction with  the PAS Staining Kit, is intended for laboratory use as a qualitative histologic stain to differentiate between acid and neutral mucins by light microscopy in  sections of formalin-fixed, paraffin-  embedded (FFPE) tissue on  a  BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Alcian Blue Staining Kit
    Alcian Blue Staining Kit The Alcian Blue Staining Kit is intended for laboratory use as a qualitative histologic stain to demonstrate weakly acidic mucopolysaccharides by light microscopy in sections of formalin- fixed, paraffin-embedded (FFPE) tissue stained on a BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Factor XIIIa (AC-1A1) Mouse Monoclonal Antibody
    Factor XIIIa (AC-1A1) Mouse Monoclonal Antibody Factor XIIIa (AC-1A1) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of Factor XIIIa in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Nerve Growth Factor Receptor (NGFR) (MRQ-21) Mouse Monoclonal Antibody
    Nerve Growth Factor Receptor (NGFR) (MRQ-21) Mouse Monoclonal Antibody NGFR (Nerve Growth Factor Receptor) (MRQ-21) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of NGFR in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    T-bet (MRQ-46) Rabbit Monoclonal Antibody
    T-bet (MRQ-46) Rabbit Monoclonal Antibody T-bet (MRQ-46) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the T-bet protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Light Green for PAS
    Light Green for PAS Light Green for PAS is intended for laboratory use in staining non-target tissue components and providing contrast with target stains in sections of formalin-fixed, paraffin-embedded (FFPE) tissue on a BenchMark Special Stains instrument.This reagent is intended as a counterstain in special stains applications.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    <i>ultra</i>View Red ISH DIG Detection Kit
    ultraView Red ISH DIG Detection Kit US Ventana Medical Systems, Inc’s (Ventana) ultraView Red ISH DIG Detection Kit is an indirect, biotin-free system for detecting DIG labeled probes. The kit is intended to identify targets by chromogenic red in situ hybridization (ISH) in sections of formalin-fixed, paraffin-embedded tissue that are stained on VENTANA BenchMark XT automated slide stainer or VENTANA BenchMark ULTRA automated slide stainer.The clinical interpretation of any staining, or the absence of staining, must be complemented by histological examination and evaluation of proper controls. Evaluation must be made by a qualified reader within the context of the patient’s clinical history and other diagnostic tests.This detection kit is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Factor XIIIa (EP3372) Rabbit Monoclonal Antibody
    Factor XIIIa (EP3372) Rabbit Monoclonal Antibody Factor XIIIa (EP3372) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of Factor XIIIa in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    GLUT1 Rabbit Polyclonal Antibody
    GLUT1 Rabbit Polyclonal Antibody GLUT1 Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the GLUT1 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Oct-4 (MRQ-10) Mouse Monoclonal Antibody
    Oct-4 (MRQ-10) Mouse Monoclonal Antibody Anti-Oct-4 (MRQ-10) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the Oct-4 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Tryptase (G3) Mouse Monoclonal Antibody
    Tryptase (G3) Mouse Monoclonal Antibody Tryptase (G3) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of tryptase in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Reticulum II Staining Kit
    Reticulum II Staining Kit The Reticulum II Staining Kit is intended for laboratory use as a qualitative histologic stain to demonstrate reticular fibers by light microscopy in sections of formalin-fixed, paraffin-embedded (FFPE) tissue stained on a BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Macrophage (HAM-56) Mouse Monoclonal Antibody
    Macrophage (HAM-56) Mouse Monoclonal Antibody Macrophage (HAM-56) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of HAM-56 in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Melanoma Associated Antigen (PNL2) Mouse Monoclonal Antibody
    Melanoma Associated Antigen (PNL2) Mouse Monoclonal Antibody Melanoma Associated Antigen (PNL2) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of PNL2 in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Mucicarmine Staining Kit
    Mucicarmine Staining Kit The Mucicarmine Staining Kit is intended for laboratory use as a qualitative histologic stain to demonstrate acid mucopolysaccharides (mucin) by light microscopy in sections of formalin-fixed, paraffin-embedded (FFPE) tissue stained on a BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    ZAP-70 (2F3.2) Mouse Monoclonal Antibody
    ZAP-70 (2F3.2) Mouse Monoclonal Antibody ZAP-70 (2F3.2) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the ZAP-70 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CD63 (NKI/C3) Mouse Monoclonal Antibody
    CD63 (NKI/C3) Mouse Monoclonal Antibody CD63 (NKI/C3) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the CD63 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Glypican-3 (1G12) Mouse Monoclonal Antibody
    Glypican-3 (1G12) Mouse Monoclonal Antibody Glypican-3 (1G12) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the Glypican-3 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-EMA (E29) Mouse Monoclonal Primary Antibody
    CONFIRM anti-EMA (E29) Mouse Monoclonal Primary Antibody CONFIRM anti-EMA (E29) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of epithelial membrane antigen by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.  This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information and proper controls.This antibody is intended for in vitro diagnostic (IVD).
    IVD For in vitro diagnostic use.
    CONFIRM anti-Melanosome (HMB45) Mouse Monoclonal Primary Antibody
    CONFIRM anti-Melanosome (HMB45) Mouse Monoclonal Primary Antibody CONFIRM anti-Melanosome (HMB45) is a mouse monoclonal antibody intended for laboratory use in the qualitative immunohistochemical detection of premelanosome protein (PMEL) by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological exanimation, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostics.
    IVD For in vitro diagnostic use.
    CINtec<sup>®</sup> Histology Kit
    CINtec® Histology Kit CE-IVD For in-vitro diagnostic use.The CINtec® Histology Kit is an immunohistochemistry assay for the qualitative detection of the p16INK4a antigen on tissue sections prepared from formalin-fixed, paraffin-embedded cervical biopsies.It is indicated to be used in conjunction with H&E-stained slides prepared from the same cervical tissue specimen as an aid to increase diagnostic accuracy and inter- observer agreement in the diagnosis of high-grade cervical intraepithelial neoplasia.The test is intended for manual use, or for use on Autostainer instruments.This assay should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.
    IVD For in vitro diagnostic use.
    CINtec Histology slide
    CINtec® Histology US-FDA CINtec® Histology is the only 510(k) p16 immunohistochemistry biomarker test for clinical/IVD use in the evaluation of cervical biopsy specimens.
    IVD For in vitro diagnostic use.
    CINtec<sup>®</sup> Histology Kit
    CINtec® Histology Kit Japan
    IVD For in vitro diagnostic use.
    Parathyroid Hormone (PTH) (MRQ-31) Mouse Monoclonal Antibody
    Parathyroid Hormone (PTH) (MRQ-31) Mouse Monoclonal Antibody Parathyroid Hormone (PTH) (MRQ-31) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the parathyroid hormone in formalin-fixed, paraffinembedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    BenchMark ULTRA PLUS
    BenchMark ULTRA PLUS The BenchMark ULTRA PLUS system uses an unprecedented, fully-automated workflow for immunohistochemistry (IHC) and in-situ hybridization (ISH) slide staining to improve turnaround time and decrease touchpoints.
    IVD For in vitro diagnostic use.
    ISH Protease 3
    ISH Protease 3 ISH Protease 3 is intended for enzymatic digestion of formalin-fixed, paraffin-embedded tissue sections, or whole cell preparations on a BenchMark IHC/ISH instrument. This reagent removes protein that surrounds the target nucleic acid sequences of interest during in situ hybridization applications.This reagent is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-CD99 (O13) Mouse Monoclonal Primary Antibody
    CONFIRM anti-CD99 (O13) Mouse Monoclonal Primary Antibody CONFIRM anti-CD99 (O13) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of CD99 by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use. 
    IVD For in vitro diagnostic use.
    CONFIRM anti-ALK1 (ALK01) Primary Antibody
    CONFIRM anti-ALK1 (ALK01) Primary Antibody CE-IVD This antibody is intended for in vitro diagnostic (IVD) use.Ventana Medical Systems’ (Ventana) CONFIRM anti-ALK1 (ALK01) Primary Antibody is a mouse monoclonal antibody directed against p80 protein present in human tissue. This antibody is intended for laboratory use to qualitatively stain sections of formalin fixed, paraffin embedded tissue on a Ventana automated slide stainer.The clinical interpretation of any staining, or the absence of staining, must be complemented by morphological studies and evaluation of proper controls. Evaluation must be made by a qualified pathologist within the context of the patient’s clinical history and other diagnostic tests. Prescription only.
    IVD For in vitro diagnostic use.
    ATRX CM Rabbit Polyclonal Antibody
    ATRX CM Rabbit Polyclonal Antibody ATRX Rabbit Polyclonal Antibody is intended for laboratory use in the detection of ATRX protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    IDH1 R132H (MRQ-67) CM Rabbit Monoclonal Antibody
    IDH1 R132H (MRQ-67) CM Rabbit Monoclonal Antibody IDH1 R132H (MRQ-67) Rabbit Monoclonal Antibody is intended for laboratory use in the detection of the IDH1 R132H mutant protein in formalin-fixed, paraffin-embedded human tissue stained inqualitative immunohistochemistry on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    IgG Rabbit Polyclonal Antibody
    IgG Rabbit Polyclonal Antibody IgG Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of IgG in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    <i>ultra</i>View SISH DNP Detection Kit
    ultraView SISH DNP Detection Kit US-FDA
    IVD For in vitro diagnostic use.
    CONFIRM anti-MITF (C5/D5) Mouse Monoclonal Primary Antibody
    CONFIRM anti-MITF (C5/D5) Mouse Monoclonal Primary Antibody CONFIRM anti-MITF (C5/D5) Mouse Monoclonal Primary Antibody is a mouse monoclonal antibody cocktail intended for laboratory use in the qualitative immunohistochemical detection of microphthalmia-associated transcription factor (MITF) protein by light microscopy   in sections of formalin-fixed, paraffin-embedded tissue on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM<sup>™</sup> anti-c-KIT (9.7) Primary Antibody
    CONFIRM™ anti-c-KIT (9.7) Primary Antibody This antibody is intended for in vitro diagnostic (IVD) use.Ventana Medical Systems' (Ventana) CONFIRM anti-c-KIT (9.7) Primary Antibody is a rabbit monoclonal antibody (IgG) directed against the C terminal (intracellular) domain of c- KIT protein and recognizes both wild type and mutant forms of the c-KIT protein. This antibody is intended for laboratory use, via light microscopy, for the qualitative detection of c-KIT protein in formalin-fixed, paraffin-embedded tissue on a Ventana automated slide stainer. CONFIRM anti-c-KIT (9.7) specifically binds to antigen located in the cell membrane and cytoplasmic regions of normal mast cells, interstitial cells of Cajal (ICC), and gastrointestinal stromal tumors (GISTs).This antibody does not cross react with PDGFR alpha, c-FMS or Flt-3. The presence of c-KIT protein in GISTs is helpful diagnostically in the identification of GISTs and their separation from other stromal lesions.1 The clinical interpretation of any staining, or the absence of staining, must be complemented by morphological studies and evaluation of proper controls. Evaluation must be made by a qualified pathologist within the context of the patient’s clinical history and other diagnostic tests. Prescription only. 1. Sarlomo-Rikala M, Kovatich H, Barusevicius A, Miettinen M. CD117: A sensitive marker for gastrointestinal stromal tumors that is more specific than CD34. Mod Pathol (1998) 11: 728-734.
    IVD For in vitro diagnostic use.
    Galectin-3 (9C4) Mouse Monoclonal Antibody
    Galectin-3 (9C4) Mouse Monoclonal Antibody Galectin-3 (9C4) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the galectin-3 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    DOG1 (SP31) Rabbit Monoclonal Antibody
    DOG1 (SP31) Rabbit Monoclonal Antibody DOG1 (SP31) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the DOG1 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-CD34 (QBEnd/10) Primary Antibody
    CONFIRM anti-CD34 (QBEnd/10) Primary Antibody Ventana Medical Systems' (Ventana) CONFIRM anti-CD34 (QBEnd/10) Primary Antibody is a mouse monoclonal antibody (IgG1) directed against human CD34. This antibody is intended for use to qualitatively identify CD34 by light microscopy in sections of formalin fixed, paraffin embedded tissue stained on a Ventana automated slide stainer.The clinical interpretation of any staining, or the absence of staining, must be complemented by morphological studies and evaluation of proper controls. Evaluation must be made by a qualified pathologist within the context of the patient’s clinical history and other diagnostic tests.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CD34 (QBEnd/10) Mouse Monoclonal Antibody
    CD34 (QBEnd/10) Mouse Monoclonal Antibody CD34 (QBEnd/10) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the CD34 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-Cytokeratin 20 (SP33) Rabbit Monoclonal Primary Antibody
    CONFIRM anti-Cytokeratin 20 (SP33) Rabbit Monoclonal Primary Antibody CONFIRM anti-Cytokeratin 20 (SP33) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of cytokeratin 20 (CK20) by light microscopy in sections of formalin- fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.  
    IVD For in vitro diagnostic use.
    CONFIRM anti-Cytokeratin 7 (SP52) Rabbit Monoclonal Primary Antibody
    CONFIRM anti-Cytokeratin 7 (SP52) Rabbit Monoclonal Primary Antibody CONFIRM anti-Cytokeratin 7 (SP52) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of cytokeratin 7 (CK7) by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-NSE (MRQ-55) Mouse Monoclonal Primary Antibody
    anti-NSE (MRQ-55) Mouse Monoclonal Primary Antibody NSE (MRQ-55) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the NSE enzyme in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Gastrin Rabbit Polyclonal Antibody
    Gastrin Rabbit Polyclonal Antibody Gastrin Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the gastrin hormone in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Trichrome Staining Kit
    Trichrome Staining Kit Trichrome Staining Kit is intended for laboratory use as a qualitative histologic stain to demonstrate collagen fibers, muscle and connective tissue by light microscopy in sections of formalin-fixed, paraffin-embedded (FFPE) tissue stained on a BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Diastase Kit
    Diastase Kit Diastase Kit, in conjunction with PAS Staining Kit (860-014 / 05279291001), is intended for use as a digestion reagent to aid in the determination of glycogen in formalin-fixed, paraffin-embedded tissue.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Lysozyme Rabbit Polyclonal Antibody
    Lysozyme Rabbit Polyclonal Antibody Lysozyme Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of lysozyme in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Uroplakin III (SP73) Rabbit Monoclonal Antibody
    Uroplakin III (SP73) Rabbit Monoclonal Antibody Uroplakin III (SP73) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the Uroplakin protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Melanoma Associated Antigen (KBA.62) Mouse Monoclonal Antibody
    Melanoma Associated Antigen (KBA.62) Mouse Monoclonal Antibody Melanoma Associated Antigen (KBA.62) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of an unidentified melanoma associated antigen in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    MUC2 (MRQ-18) Mouse Monoclonal Antibody
    MUC2 (MRQ-18) Mouse Monoclonal Antibody MUC2 (MRQ-18) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the MUC2 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    BenchMark Special Stains AFB Staining Kit
    BenchMark Special Stains AFB Staining Kit The BenchMark Special Stains AFB Staining Kit is intended for laboratory use as a qualitative histologic stain to demonstrate acid-fast bacteria (AFB) by light microscopy in sections of formalinfixed, paraffin-embedded (FFPE) tissue stained on a BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Steiner II Staining Kit
    Steiner II Staining Kit The Steiner II Staining Kit is intended for laboratory use as a qualitative histologic stain to demonstrate argyrophilic microorganisms by light microscopy in sections of formalin-fixed, paraffin-embedded (FFPE) tissue stained on a BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> anti-Helicobacter pylori (SP48) Rabbit Monoclonal Primary Antibody
    VENTANA® anti-Helicobacter pylori (SP48) Rabbit Monoclonal Primary Antibody VENTANA anti-Helicobacter pylori (SP48) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of Helicobacter pylori by light microscopy in sections of formalin-fixed, paraffin-embedded gastric biopsy tissue stained on a Benchmark IHC/ISH instrument. Immunohistochemical staining with this antibody product may aid in the diagnosis of Helicobacter pylori infection.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use. 
    IVD For in vitro diagnostic use.
    Congo Red Staining Kit
    Congo Red Staining Kit Congo Red Staining Kit is intended for laboratory use as a qualitative histologic stain to demonstrate amyloid in sections of formalin-fixed, paraffinembedded (FFPE) tissue stained on a BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CD25 (4C9) Mouse Monoclonal Antibody
    CD25 (4C9) Mouse Monoclonal Antibody CD25 (4C9) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of CD25 in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-PAX-8 (MRQ-50) Mouse Monoclonal Primary Antibody
    anti-PAX-8 (MRQ-50) Mouse Monoclonal Primary Antibody PAX-8 (MRQ-50) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the PAX-8 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    PAS Staining Kit
    PAS Staining Kit The PAS Staining Kit is intended for laboratory use as a qualitative histologic stain to demonstrate the presence of glycogen, basement membrane and fungal organisms by light microscopy in sections of formalin-fixed, paraffin- embedded tissue (FFPE) stained on a BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    PSAP (PASE/4LJ) Mouse Monoclonal Antibody
    PSAP (PASE/4LJ) Mouse Monoclonal Antibody PSAP (PASE/4LJ) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the PSAP protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    PAX8 (EP331) Rabbit Monoclonal Antibody
    PAX8 (EP331) Rabbit Monoclonal Antibody PAX-8 (EP331) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the PAX-8 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-p57<sup>Kip2</sup> (Kp10) Mouse Monoclonal Primary Antibody
    anti-p57Kip2 (Kp10) Mouse Monoclonal Primary Antibody p57Kip2 (Kp10) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the p57Kip2 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    E-cadherin (EP700Y) Rabbit Monoclonal Antibody
    E-cadherin (EP700Y) Rabbit Monoclonal Antibody E-cadherin (EP700Y) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the E-cadherin protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-MART-1/melan A (A103) Mouse Monoclonal Primary Antibody
    CONFIRM anti-MART-1/melan A (A103) Mouse Monoclonal Primary Antibody CONFIRM anti-MART-1/melan A (A103) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of melan A by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    MyoD1 (EP212) Rabbit Monoclonal Antibody
    MyoD1 (EP212) Rabbit Monoclonal Antibody MyoD1 (EP212) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the MyoD1 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Mammaglobin (31A5) Rabbit Monoclonal Antibody
    Mammaglobin (31A5) Rabbit Monoclonal Antibody Mammaglobin (31A5) Rabbit Monoclonal Antibody is intended for laboratory use in the detection of the mammaglobin glycoprotein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    BOB.1 (SP92) Rabbit Monoclonal Antibody
    BOB.1 (SP92) Rabbit Monoclonal Antibody BOB.1 (SP92) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of BOB.1 in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    SOX-11 (MRQ-58) Mouse Monoclonal Antibody
    SOX-11 (MRQ-58) Mouse Monoclonal Antibody SOX-11 (MRQ-58) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the SOX-11 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    SV40 (MRQ-4) Mouse Monoclonal Antibody
    SV40 (MRQ-4) Mouse Monoclonal Antibody SV40 (MRQ-4) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of Simian Virus 40 (SV40) antigen in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-SOX-2 (SP76) Rabbit Monoclonal Primary Antibody
    anti-SOX-2 (SP76) Rabbit Monoclonal Primary Antibody SOX-2 (SP76) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the SOX-2 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-CD23 (SP23) Rabbit Monoclonal Primary Antibody
    CONFIRM anti-CD23 (SP23) Rabbit Monoclonal Primary Antibody CONFIRM anti-CD23 (SP23) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of CD23 by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a Benchmark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CD57 (NK-1) Mouse Monoclonal Antibody
    CD57 (NK-1) Mouse Monoclonal Antibody CD57 (NK-1) Mouse Monoclonal Antibody is intended for laboratory use in the detection of the CD57 glycan in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-CD79a (SP18) Rabbit Monoclonal Primary Antibody
    CONFIRM anti-CD79a (SP18) Rabbit Monoclonal Primary Antibody CONFIRM anti-CD79a (SP18) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of CD79a by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CD163 (MRQ-26) Mouse Monoclonal Antibody
    CD163 (MRQ-26) Mouse Monoclonal Antibody CD163 (MRQ-26) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the CD163 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CD56 (MRQ-42) Rabbit Monoclonal Antibody
    CD56 (MRQ-42) Rabbit Monoclonal Antibody CD56 (MRQ-42) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the CD56 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CD21 (EP3093) Rabbit Monoclonal Antibody
    CD21 (EP3093) Rabbit Monoclonal Antibody CD21 (EP3093) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the CD21 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    p21<sup>WAF1</sup> (DCS-60.2) Mouse Monoclonal Antibody
    p21WAF1 (DCS-60.2) Mouse Monoclonal Antibody p21WAF1 (DCS-60.2) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the p21WAF1 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Phosphohistone H3 (PHH3) Rabbit Polyclonal Antibody
    Phosphohistone H3 (PHH3) Rabbit Polyclonal Antibody Phosphohistone H3 (PHH3) Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the Phosphohistone H3 (PHH3) protein in formalin-fixed, paraffinembedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-Prostate Specific Antigen (PSA) Rabbit Polyclonal Primary Antibody
    CONFIRM anti-Prostate Specific Antigen (PSA) Rabbit Polyclonal Primary Antibody CONFIRM anti-Prostate Specific Antigen (PSA) Rabbit Polyclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of PSA by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-Progesterone Receptor (PR) (1E2) Rabbit Monoclonal Primary Antibody
    CONFIRM anti-Progesterone Receptor (PR) (1E2) Rabbit Monoclonal Primary Antibody CONFIRM anti-Progesterone Receptor (PR) (1E2) Rabbit Monoclonal (IgG) Primary Antibody is intended for laboratory use in the qualitative detection of progesterone receptor (PR) antigen in sections of formalin-fixed, paraffin-embedded tissue on a VENTANA automated slide stainer with VENTANA detection kits and ancillary reagents. CONFIRM anti-PR (1E2) is directed against an epitope present on human progesterone receptor protein located in the nucleus of PR positive normal and neoplastic cells.CONFIRM anti-PR (1E2) is indicated as an aid in the management, prognosis, and prediction of hormone therapy for breast carcinoma.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. Prescription use only.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-Pan Keratin (AE1/AE3/PCK26) Primary Antibody
    anti-Pan Keratin (AE1/AE3/PCK26) Primary Antibody Anti-Pan Keratin (AE1/AE3/PCK26) Primary Antibody is an antibody cocktail intended for laboratory use in the qualitative immunohistochemical detection of most acidic cytokeratins and all basic cytokeratins by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    PD-1 (NAT105) Mouse Monoclonal Antibody
    PD-1 (NAT105) Mouse Monoclonal Antibody PD-1 (NAT105) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the PD-1 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Hemoglobin A (SP212) Rabbit Monoclonal Primary Antibody
    Hemoglobin A (SP212) Rabbit Monoclonal Primary Antibody Hemoglobin A (SP212) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the hemoglobin A protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-INI-1 (MRQ-27) Mouse Monoclonal Primary Antibody
    anti-INI-1 (MRQ-27) Mouse Monoclonal Primary Antibody INI-1 (MRQ-27) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the INI-1 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-IgG4 (MRQ-44) Mouse Monoclonal Antibody
    anti-IgG4 (MRQ-44) Mouse Monoclonal Antibody IIgG4 (MRQ-44) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of IgG4 in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    NKX3.1 (EP356) Rabbit Monoclonal Primary Antibody
    NKX3.1 (EP356) Rabbit Monoclonal Primary Antibody NKX3.1 (EP356) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of NKX3.1 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-TFE3 (MRQ-37) Rabbit Monoclonal Primary Antibody
    anti-TFE3 (MRQ-37) Rabbit Monoclonal Primary Antibody TFE3 (MRQ-37) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the TFE3 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    TdT Rabbit Polyclonal Antibody
    TdT Rabbit Polyclonal Antibody TdT Rabbit Polyclonal Antibody is intended for laboratory use in the detection of TdT in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Desmoglein 3 (5G11) Mouse Monoclonal Primary Antibody
    Desmoglein 3 (5G11) Mouse Monoclonal Primary Antibody Desmoglein 3 (5G11) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the desmoglein 3 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-Desmin (DE-R-11) Primary Antibody
    CONFIRM anti-Desmin (DE-R-11) Primary Antibody CONFIRM anti-Desmin (DE-R-11) is intended for laboratory use in the qualitative immunohistochemical detection of desmin by light microscopy in sections of formalin-fixed, paraffinembedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-EGFR (5B7) Rabbit Monoclonal Primary Antibody
    CONFIRM anti-EGFR (5B7) Rabbit Monoclonal Primary Antibody This antibody is intended for in vitro diagnostic (IVD) use.Ventana Medical Systems’ (Ventana) CONFIRM anti-EGFR (5B7) Rabbit Monoclonal Antibody is a primary antibody designed to qualitatively detect the presence of the internal domain of EGFR via light microscopy in formalin fixed, paraffin embedded tissue following staining on a Ventana automated slide stainer. This antibody is directed against the internal domain of the human Epidermal Growth Factor Receptor (also called EGFR, ErbB1 or HER 1).The clinical interpretation of any staining, or the absence of staining, must be complemented by morphological studies and evaluation of proper controls. Evaluation must be made by a qualified pathologist within the context of the patient’s clinical history and other diagnostic tests.
    IVD For in vitro diagnostic use.
    anti-FoxP1 (SP133) Rabbit Monoclonal Primary Antibody
    anti-FoxP1 (SP133) Rabbit Monoclonal Primary Antibody anti-FoxP1 (SP133) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of FoxP1 in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Factor VIII-R Ag. Rabbit Polyclonal Antibody
    Factor VIII-R Ag. Rabbit Polyclonal Antibody Factor VIII-R Ag. Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the Factor VIII-R Ag. protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    BenchMark ULTRA IHC/ISH System
    BenchMark ULTRA The BenchMark ULTRA IHC instrument is for the pathology professional who values improved quality, reliability and workflow efficiency.
    IVD For in vitro diagnostic use.
    OptiView DAB IHC Detection Kit
    OptiView DAB IHC Detection Kit OptiView DAB IHC Detection Kit (OptiView) is an indirect, biotin-free system for detecting mouse IgG, mouse IgM, and rabbit primary antibodies. The kit is intended to identify targets by immunohistochemistry (IHC) in sections of formalin-fixed, paraffin-embedded and frozen tissue that are stained on the VENTANA automated slide stainers and visualized by light microscopy. The clinical interpretation of any staining, or the absence of staining, must be complemented by morphological studies and evaluation of proper controls.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    A-1-Antitrypsin Rabbit Polyclonal Antibody
    A-1-Antitrypsin Rabbit Polyclonal Antibody A-1-Antitrypsin Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the A-1-Antitrypsin protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-ALK (D5F3) Rabbit Monoclonal Primary Antibody
    anti-ALK (D5F3) Rabbit Monoclonal Primary Antibody Anti-ALK (D5F3) Rabbit Monoclonal Primary Antibody (anti-ALK (D5F3)) is intended for laboratory use in the detection of the anaplastic lymphoma kinase (ALK) protein in formalin- fixed, paraffin-embedded neoplastic tissue stained on a VENTANA BenchMark XT or BenchMark GX immunohistochemical (IHC) automated slide stainer.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    ACTH Rabbit Polyclonal Antibody
    ACTH Rabbit Polyclonal Antibody ACTH Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the ACTH protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-CD30 (Ber-H2) Mouse Monoclonal Primary Antibody
    anti-CD30 (Ber-H2) Mouse Monoclonal Primary Antibody
    IVD For in vitro diagnostic use.
    anti-bcl-2 (SP66) Rabbit Monoclonal Primary Antibody
    anti-bcl-2 (SP66) Rabbit Monoclonal Primary Antibody Anti-bcl-2 (SP66) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of B-cell lymphoma 2 protein (bcl-2) by light microscopy in sections of formalin- fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.  
    IVD For in vitro diagnostic use.
    Amplification Kit
    Amplification Kit Ventana Medical Systems, Inc.’s (Ventana) Amplification Kit may be used in conjunction with VENTANA detection kits to increase the signal intensity of weak staining mouse and rabbit primary antibodies. The kit is to be used for qualitative staining of formalin-fixed, paraffin-embedded tissue, frozen tissue or cytological preparations on VENTANA automated side stainers with VENTANA primary antibodies, detection kits and ancillary reagents.The clinical interpretation of any staining, or the absence of staining, must be complemented by morphological studies and evaluation of proper controls. Evaluation must be made by a qualified pathologist within the context of the patient’s clinical history and other diagnostic tests.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    HER2
    VENTANA® anti-HER2/neu (4B5) Rabbit Monoclonal Primary Antibody CE-IVD HER2/neu (4B5) Rabbit Monoclonal Primary Antibody, VENTANA, one of over 250 optimized pre-diluted reagents for use on the BenchMark IHC/ISH automated slide staining instruments by Roche Diagnostics.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> anti-PMS2 (A16-4) Mouse Monoclonal Primary Antibody
    VENTANA® anti-PMS2 (A16-4) Mouse Monoclonal Primary Antibody For use with the VENTANA MMR IHC Panel VENTANA anti-PMS2 (A16-4) Mouse Monoclonal Primary Antibody (VENTANA anti-PMS2 (A16-4) antibody) is intended for laboratory use in the qualitative immunohistochemical detection of PMS2 protein in formalin-fixed, paraffin-embedded (FFPE) sections by light microscopy. VENTANA anti-PMS2 (A16-4) antibody is ready to use on a BenchMark IHC/ISH instrument with the OptiView DAB IHC Detection Kit, OptiView Amplification Kit, and ancillary reagents.VENTANA anti-PMS2 (A16-4) antibody is part of the VENTANA MMR RxDx Panel and the VENTANA MMR IHC Panel listed in Table 1.Table 1. Diagnostic Indications for VENTANA MMR Panels.Panel NamePanel Antibodies[a]Clinical ApplicationVENTANA MMR RxDx PanelMLH1, PMS2, MSH2 and MSH6The VENTANA MMR RxDx Panel is indicated as an aid in identifying deficient MMR (dMMR) endometrial carcinoma patients eligible for treatment with JEMPERLI (dostarlimab) in accordance with the approved therapeutic product labelingVENTANA MMR IHC PanelMLH1, PMS2, MSH2, MSH6 and BRAF V600EThe VENTANA MMR IHC Panel is indicated in detection of mismatch repair protein deficiency as a test for the identification of individuals at risk for Lynch syndrome in patients diagnosed with colorectal cancer (CRC), and, with BRAF V600E status, as an aid to differentiate between sporadic and probable Lynch syndrome CRC in the absence of MLH1 protein expression.[a] MLH1- VENTANA anti-MLH1 (M1) Mouse Monoclonal Primary Antibody PMS2- VENTANA anti-PMS2 (A16-4) Mouse Monoclonal Primary Antibody MSH2- VENTANA anti-MSH2 (G219-1129) Mouse Monoclonal Primary Antibody MSH6- VENTANA anti-MSH6 (SP93) Rabbit Monoclonal Primary Antibody BRAF- VENTANA anti-BRAF V600E (VE1) Mouse Monoclonal Primary AntibodyTest results of this panel should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-CMV Blend (8B1.2, 1G5.2 &amp; 2D4.2) Mouse Monoclonal Primary Antibody
    anti-CMV Blend (8B1.2, 1G5.2 & 2D4.2) Mouse Monoclonal Primary Antibody IVD This antibody is intended for in vitro diagnostic (IVD) use.The Cell Marque CMV (8B1.2, 1G5.2 & 2D4.2) antibody is intended for qualified laboratories to qualitatively identify by light microscopy the presence of associated antigens in sections of formalin-fixed, paraffin-embedded tissue sections using IHC test methods. Use of this antibody is indicated, subsequent to clinical differential diagnosis, as an aid in the identification of cytomegalovirus within the context of an antibody panel, the patient’s clinical history, and other diagnostic tests evaluated by a qualified pathologist.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> anti-MLH1 (M1) Mouse Monoclonal Primary Antibody
    VENTANA® anti-MLH1 (M1) Mouse Monoclonal Primary Antibody For use with the VENTANA MMR IHC Panel VENTANA anti-MLH1 (M1) Mouse Monoclonal Primary Antibody (VENTANA anti-MLH1 (M1) antibody) is intended for the qualitative detection of MLH1 protein in formalin-fixed, paraffinembedded tissue sections. VENTANA anti-MLH1 (M1) antibody is ready to use on BenchMark IHC/ISH instruments with the OptiView DAB IHC Detection Kit and ancillary reagents.VENTANA anti-MLH1 (M1) antibody is part of the VENTANA MMR IHC Panel which includes VENTANA anti-PMS2 (A16-4) Mouse Monoclonal Primary Antibody, VENTANA anti-MSH2 (G219- 1129) Mouse Monoclonal Primary Antibody, VENTANA anti-MSH6 (SP93) Rabbit Monoclonal Primary Antibody and VENTANA anti-BRAF V600E (VE1) Mouse Monoclonal Primary Antibody. The VENTANA MMR IHC Panel is indicated for the detection of mismatch repair protein deficiency as a test for the identification of individuals at risk for Lynch syndrome in patients diagnosed with colorectal cancer (CRC), and, with BRAF V600E status, as an aid to differentiate between sporadic and probable Lynch syndrome CRC in the absence of MLH1 protein expression.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> anti-MSH2 (G219-1129) Mouse Monoclonal Primary Antibody
    VENTANA® anti-MSH2 (G219-1129) Mouse Monoclonal Primary Antibody For use with the VENTANA MMR IHC Panel VENTANA anti-MSH2 (G219-1129) Mouse Monoclonal Primary Antibody (VENTANA anti-MSH2 (G219-1129) antibody) is intended for the qualitative detection of MSH2 protein in formalinfixed, paraffin-embedded tissue sections. VENTANA anti-MSH2 (G219- 1129) antibody is ready to use on BenchMark IHC/ISH instruments with the OptiView DAB IHC Detection Kit and ancillary reagents.VENTANA anti-MSH2 (G219-1129) antibody is part of the VENTANA MMR IHC Panel which includes VENTANA anti-MLH1 (M1) Mouse Monoclonal Primary Antibody, VENTANA antiPMS2 (A16-4) Mouse Monoclonal Primary Antibody, VENTANA antiMSH6 (SP93) Rabbit Monoclonal Primary Antibody and VENTANA antiBRAF V600E (VE1) Mouse Monoclonal Primary Antibody. The VENTANA MMR IHC Panel is indicated for the detection of mismatch repair protein deficiency as a test for the identification of individuals at risk for Lynch syndrome in patients diagnosed with colorectal cancer (CRC), and, with BRAF V600E status, as an aid to differentiate between sporadic and probable Lynch syndrome CRC in the absence of MLH1 protein expression.These products should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.Intended for in vitro diagnostic (IVD) use.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    anti-CMV Blend (8B1.2, 1G5.2 &amp; 2D4.2) Mouse Monoclonal Primary Antibody
    anti-CMV Blend (8B1.2, 1G5.2 & 2D4.2) Mouse Monoclonal Primary Antibody RUO Anti-CMV (8B1.2, 1G5.2 & 2D4.2) may be used as the primary antibody for immunohistochmical staining of formulin-fixed, paraffin-embedded tissue sections.
    GLU For general laboratory use.
    <b>navify<sup>®</sup></b> Pathology Lab Advantage
    navify® Pathology Lab Advantage The navify® Pathology Lab Advantage solution supports support workflow automation within the anatomical pathology laboratory through:1) Tracking and specimen chain of custody throughout the life of a sample.2) Improved patient safety by reducing errors and minimizing the risk of mislabeling, positive patient identification, and single- piece flow.3) State-of-the-art informatics and business intelligence.4) Promoting productivity and a lean workflow.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY UltraMap anti-Ms Alk Phos
    DISCOVERY UltraMap anti-Ms Alk Phos Biotin-free DAB Detection Systems for the Ventana DISCOVERY Series of Instruments UltraMap anti-Ms Alk Phos is a biotin-free detection systems based on proprietary multimer technology. It consists of a robust chemistry that provides clean background in combination with enhanced specificity and sensitivity, which increases the signal-to-noise ratio. It is designed to be used in conjunction with the DISCOVERY Series of instruments and VENTANA ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY UltraMap anti-Rb Alk Phos
    DISCOVERY UltraMap anti-Rb Alk Phos Biotin-free DAB Detection Systems for the Ventana DISCOVERY Series of Instruments UltraMap anti-Ms Alk Phos is a biotin-free detection systems based on proprietary multimer technology. It consists of a robust chemistry that provides clean background in combination with enhanced specificity and sensitivity, which increases the signal-to-noise ratio. It is designed to be used in conjunction with the DISCOVERY Series of instruments and VENTANA ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY UltraMap anti-Ms HRP
    DISCOVERY UltraMap anti-Ms HRP Biotin-free DAB Detection Systems for the Ventana DISCOVERY Series of Instruments UltraMap anti-Ms is a biotin-free detection systems based on proprietary multimer technology. It consists of a robust chemistry that provides clean background in combination with enhanced specificity and sensitivity, which increases the signal-to-noise ratio. It is designed to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY UltraMap anti-Rb HRP
    DISCOVERY UltraMap anti-Rb HRP Biotin-free DAB Detection Systems for the Ventana DISCOVERY Series of Instruments UltraMap anti-Rb is a biotin-free detection systems based on proprietary multimer technology. It consists of a robust chemistry that provides clean background in combination with enhanced specificity and sensitivity, which increases the signal-to-noise ratio. It is designed to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY OmniMap anti-Rt HRP (RUO)
    DISCOVERY OmniMap anti-Rt HRP (RUO) Biotin-free DAB Detection Systems for the Ventana DISCOVERY Series of Instruments OmniMap anti-Rt HRP is a biotin-free conjugate based on proprietary multimer technology. It consists of a robust chemistry that provides clean background in combination with enhanced specificity and sensitivity, which increases the signal-to-noise ratio. It is designed to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Yellow Kit
    DISCOVERY Yellow Kit DISCOVERY Yellow Kit is a detection kit used for demonstrating the presence of unique antigens in tissues and cells.The DISCOVERY Yellow Kit was designed for antigen localization in frozen sections and/or formalin-fixed, paraffin-embedded tissue sections, to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Purple kit (RUO)
    DISCOVERY Purple kit (RUO) The DISCOVERY Purple Kit was designed for chromogenic antigen localization in frozen sections or formalin-fixed, paraffin-embedded tissue sections, to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ conjugates and ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    mRNA Link (RUO)
    mRNA Link (RUO) mRNA Link is a ready to use ancillary kit for RNAscope® used to quench previously bound HRP which is necessary for assays that target 2 or more mRNA targets. mRNA Link functions without increasing on slide stringency and therefore does not impact hybridized DNA probes.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY RedMap Kit (RUO)
    DISCOVERY RedMap Kit (RUO) Fast Red Detection Kit for the Ventana DISCOVERY Series of Instruments The DISCOVERY RedMap Kit was designed for antigen localization in cytological preparations, frozen sections, or formalin-fixed, paraffin-embedded tissue sections.The RedMap Kit was designed to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Goat Ig Block
    DISCOVERY Goat Ig Block DISCOVERY Goat Ig Block is a blocking solution consisting of casein and goat globulins in PBS.The DISCOVERY Goat Ig Block helps block non-specific binding of antibodies during immunohistochemical (IHC) and in situ hybridization (ISH) protocols on the DISCOVERY series of instruments. It can be used at any blocking step in a procedure.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY OmniMap anti-Ms HRP (RUO)
    DISCOVERY OmniMap anti-Ms HRP (RUO) Biotin-free DAB Detection Systems for the Ventana DISCOVERY Series of Instruments OmniMap anti-Ms HRP is a biotin-free conjugate based on proprietary multimer technology. It consists of a robust chemistry that provides clean background in combination with enhanced specificity and sensitivity, which increases the signal-to-noise ratio. It is designed to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY mRNA Duplex Amp Kit
    DISCOVERY mRNA Duplex Amp Kit DISCOVERY mRNA Duplex Amp Kit is a user fillable kit to be filled with the appropriate ACD reagents. This kit is to be utilized alongside the corresponding Sample Prep Kit and mRNA detection kits on DISCOVERY staining platforms.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY mRNA RED Probe Amplification Kit
    DISCOVERY mRNA RED Probe Amplification Kit DISCOVERY mRNA RED Probe Amplification Kit is a user fillable kit to be filled with the appropriate ACD reagents. This kit is to be utilized alongside the corresponding mRNA amplification and mRNA detection kits on DISCOVERY staining platforms.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY DAB Map Kit (RUO)
    DISCOVERY DAB Map Kit (RUO) DAB Detection Kit for the Ventana DISCOVERY Series of Instruments The DAB Map Kit was designed for antigen localization in cytological preparations, frozen sections, or formalin-fixed, paraffin-embedded tissue sections.The DAB Map Kit was designed to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY ChromoMap Red Kit (RUO)
    DISCOVERY ChromoMap Red Kit (RUO) Biotin-free Fast Red Detection Kit for the Ventana DISCOVERY Series of Instruments The ChromoMap Red Kit was designed for biotin-free antigen localization in frozen sections or formalin-fixed, paraffin-embedded tissue sections, to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY CC1
    DISCOVERY CC1 DISCOVERY CC1 is a Tris based buffer, which must not be diluted.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY anti-DIG AP Multimer (RUO)
    DISCOVERY anti-DIG AP Multimer (RUO) DISCOVERY anti-DIG AP Multimer (RUO) is an anti-DIG antibody conjugate labeled with Alkaline Phosphatase to be used with any AP substrate to detect DIG labeled probes.DISCOVERY anti-DIG AP Multimer (RUO) is designed to be used in conjunction with the DISCOVERY XT and DISCOVERY ULTRA (DISCOVERY series) instruments and VENTANA ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Anti-Prion (99) Research Kit
    DISCOVERY Anti-Prion (99) Research Kit Biotin-free Fast Red Detection Kit for the Ventana DISCOVERY Series of Instruments Anti-Prion ( 99) is a mouse monoclonal antibody derived from hybridoma for use on VENTANA automated slide strainers. The Anti-Prion (99) Research Kit contains the Anti-Prion (99) antibody and detection chemistry required to perform the assay.For Research Use Only. Not for use in diagnostic procedures.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY OmniMap anti-Rb HRP (RUO)
    DISCOVERY OmniMap anti-Rb HRP (RUO) Biotin-free DAB Detection Systems for the Ventana DISCOVERY Series of Instruments OmniMap anti-Rb HRP is a biotin-free conjugate based on proprietary multimer technology. It consists of a robust chemistry that provides clean background in combination with enhanced specificity and sensitivity, which increases the signal-to-noise ratio. It is designed to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY mRNA Purple HRP Detection Kit
    DISCOVERY mRNA Purple HRP Detection Kit The DISCOVERY mRNA Purple HRP Detection Kit is to be used with a third party Universal HRP Kit. It will enable researchers to stain their mRNA targets of interest with a purple chromogen.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY mRNA Teal HRP Detection Kit
    DISCOVERY mRNA Teal HRP Detection Kit The DISCOVERY mRNA Teal HRP Detection Kit is to be used with a third party Universal HRP. It will enable researchers to stain mRNA targets of interest with a Teal chromogen.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY ChromoMap DAB Kit (RUO)
    DISCOVERY ChromoMap DAB Kit (RUO) Biotin-free DAB Detection Kit for the Ventana DISCOVERY Series of Instruments The ChromoMap DAB Kit was designed for chromogenic antigen localization in frozen sections or formalin-fixed, paraffin-embedded tissue sections, to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ conjugates and ancillary reagents for optimal performance.
    IVD For in vitro diagnostic use.
    INFORM EBER (Epstein-Barr Virus Early RNA) Probe
    INFORM EBER (Epstein-Barr Virus Early RNA) Probe INFORM EBER (Epstein-Barr Virus Early RNA) Probe is intended for laboratory use in the qualitative in situ hybridization (ISH) detection of cells expressing Epstein-Barr encoded RNA (EBER) by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Green for Trichrome
    Green for Trichrome Green for Trichrome, in conjunction with Trichrome Staining Kit, is intended for laboratory use as a qualitative histologic stain to demonstrate collagen fibers, muscle and connective tissue by light microscopy in sections of formalin-fixed, paraffin-embedded (FFPE) tissue stained on a BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Gram Staining Kit
    Gram Staining Kit Gram Staining Kit is intended for use as a qualitative histologic stain to demonstrate gram-negative and gram-positive bacteria in formalin-fixed, paraffin-embedded tissue.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Jones Staining Kit
    Jones Staining Kit The Jones Staining Kit is intended for laboratory use as a qualitative histologic stain to demonstrate capillary basement membranes by light microscopy in sections of formalin-fixed, paraffinembedded (FFPE) tissue stained on the BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Amp HQ Kit
    DISCOVERY Amp HQ Kit The DISCOVERY Amplification HQ Kit isa tyramide based amplification kit designed to be used in conjunction with a DISCOVERY Amplification Anti-HQ Multimer and DISCOVERY HQ Multimer detection kits to allow the detection of lower expressing targets on the DISCOVERY series of instruments.
    IVD For in vitro diagnostic use.
    CONFIRM anti-CD45, LCA (RP2/18) Primary Antibody
    CONFIRM anti-CD45, LCA (RP2/18) Primary Antibody CONFIRM anti-CD45, LCA (RP2/18) Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of CD45 by light microscopy in sections of formalin-fixed, paraffin-embedded tissuestainedon a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-CD43 (L60) Mouse Monoclonal Primary Antibody
    anti-CD43 (L60) Mouse Monoclonal Primary Antibody Anti-CD43 (L60) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of CD43 by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Iron Staining Kit
    Iron Staining Kit The Iron Staining Kit is intended for laboratory use as a qualitative histologic stain to demonstrate iron pigment by light microscopy in sections of formalinfixed, paraffin-embedded (FFPE) tissue stained on a BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Giemsa Staining Kit
    Giemsa Staining Kit The Giemsa Staining Kit is intended for laboratory use as a qualitative histologic stain to demonstrate Helicobacter pylori in the stomach and differentiate hematopoietic cells by light microscopy in sections of formalin-fixed, paraffinembedded (FFPE) tissue stained on BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Jones Light Green Staining Kit
    Jones Light Green Staining Kit The Jones Light Green Staining Kit is intended for laboratory use as a qualitative histologic stain to demonstrate capillary basement membranes by light microscopy in sections of formalin-fixed, paraffinembedded (FFPE) tissue stained on the BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    GMS II Staining Kit
    GMS II Staining Kit GMS II Staining Kit is intended for laboratory use as a qualitative histologic stain to demonstrate polysaccharides in the cell walls of fungal organisms by light microscopy in sections of formalinfixed, paraffin-embedded (FFPE) tissue stained on the BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> HE 600 Eosin
    VENTANA® HE 600 Eosin VENTANA HE 600 Eosin is intended for use as a qualitative histologic stain to demonstrate cytoplasmic staining by light microscopy in sections of formalin-fixed, paraffin-embedded (FFPE) tissue stained on the VENTANA HE 600 system. The product should be interpreted by a qualified pathologist in conjunction with relevant clinical information, and proper controls. This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> HE 600 Hematoxylin
    VENTANA® HE 600 Hematoxylin VENTANA HE 600 Hematoxylin is intended for use as a qualitative histologic stain to demonstrate nucleic acid staining by light microscopy in sections of formalin-fixed, paraffin-embedded (FFPE) tissue stained on the VENTANA HE 600 system. The product should be interpreted by a qualified pathologist in conjunction with relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    INFORM HER2 Dual ISH DNA Probe Cocktail Assay
    INFORM HER2 Dual ISH DNA Probe Cocktail Assay
    IVD For in vitro diagnostic use.
    CONFIRM anti-Topoisomerase IIα (JS5B4) Rabbit Monoclonal Primary Antibody
    CONFIRM anti-Topoisomerase IIα (JS5B4) Rabbit Monoclonal Primary Antibody CONFIRM anti-Topoisomerase IIα (JS5B4) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of topoisomerase IIα by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-Tyrosinase (T311) Mouse Monoclonal Primary Antibody
    CONFIRM anti-Tyrosinase (T311) Mouse Monoclonal Primary Antibody CONFIRM anti-Tyrosinase (T311) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immuno-histochemical detection of tyrosinase by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic use. 
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> anti-MSH6 (SP93) Rabbit Monoclonal Primary Antibody
    VENTANA® anti-MSH6 (SP93) Rabbit Monoclonal Primary Antibody For use with the VENTANA MMR IHC Panel VENTANA anti-MSH6 (SP93) Rabbit Monoclonal Primary Antibody (VENTANA anti-MSH6 (SP93) antibody) is intended for the qualitative detection of MSH6 protein in formalin-fixed, paraffin-embedded tissue sections. VENTANA- anti- MSH6 (SP93) antibody is ready to use on BenchMark ULTRA, XT and GX instruments with the OptiView DAB IHC Detection Kit and ancillary reagents.VENTANA anti-MSH6 (SP93) antibody is part of the VENTANA MMR IHC Panel which includes VENTANA anti-MLH1 (M1) Mouse Monoclonal Primary Antibody, VENTANA anti-PMS2 (A16-4) Mouse Monoclonal Primary Antibody, VENTANA anti-MSH2 (G219-1129) Mouse Monoclonal Primary Antibody and VENTANA anti-BRAF V600E (VE1) Mouse Monoclonal Primary Antibody.The VENTANA MMR IHC Panel is indicated for the detection of mismatch repair protein deficiency as a test for the identification of individuals at risk for Lynch syndrome in patients diagnosed with colorectal cancer (CRC), and, with BRAF V600E status, as an aid to differentiate between sporadic and probable Lynch syndrome CRC in the absence of MLH1 protein expression.These products should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Napsin A Rabbit Polyclonal Antibody
    Napsin A Rabbit Polyclonal Antibody Napsin A Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the Napsin A protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    IHC Stain Automation – BenchMark GX pathology lab instrument
    BenchMark GX IHC ISH system BenchMark GX is designed for laboratories manually performing immunohistochemistry and/or in situ hybridization, and where consistency, efficiency and quality are of utmost importance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY FITC Kit (RUO)
    DISCOVERY FITC Kit (RUO) Biotin-free FITC Detection Kit for the Ventana DISCOVERY Series of Instruments (DISCOVERY ULTRA or DISCOVERY XT). This product is intended to be used by researchers wanting to visualize their IHC or ISH results with a fluorescent microscope. The following characteristics of DISCOVERY FITC are provided so that a proper filter can be used:Excitation wavelength: 490nm Emission wavelength 525nm
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Amp BF Kit
    DISCOVERY Amp BF Kit Automated immunohistochemistry (IHC) and in situ hybridization (ISH) are powerful molecular biology techniques for demonstrating the presence of proteins or unique nucleic acid sequences in tissue sections. The DISCOVERY Amp BF Kit is a tyramide based amplification kit designed to be used in conjunction with DISCOVERY Amplification anti-BF multimer, and DISCOVERY multimer detection kits to allow the detection of lower expressing targets on the DISCOVERY series of instruments.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY DCC Kit
    DISCOVERY DCC Kit The DISCOVERY DCC Kit was designed for fluorescent antigen localization in frozen sections or formalin-fixed, paraffin-embedded (FFPE) tissue sections, visualized with a fluorescent microscope. Use in conjunction with the DISCOVERY HRP detection systems including DISCOVERY HQ HRP detection, OmniMap HRP detection, and UltraMap HRP detection kits, DISCOVERY series of instruments, and ancillary reagents for optimal performance. DISCOVERY Inhibitor is required for use with DISCOVERY DCC Kit and should be purchased separately.The following characteristics of the DISCOVERY DCC Kit are provided so that proper microscope settings can be used: Excitation wavelength: 436nm Emission wavelength: 480nmIf the DISCOVERY DCC is to be used in conjunction with other DISCOVERY fluors, it is recommended that a filter with the following specifications be used in order to minimize the amount of bleed through.Excitation: 436/20nmBeamsplitter: 455nmEmission: 480/30nm
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Rhodamine Kit
    DISCOVERY Rhodamine Kit Biotin-free Rhodamine Detection Kit is used with the VENTANA Series of Instruments. This product is intended to be used by researchers wanting to visualize their IHC or ISH results with a fluorescent microscope. The following characteristics of DISCOVERY Rhodamine are provided so that a proper filter can be used: Excitation wavelength: 542nm Emission wavelength 568 nm
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Red 610 Kit
    DISCOVERY Red 610 Kit The DISCOVERY Red 610 Kit was designed for fluorescent antigen localization in frozen sections or formalin-fixed, paraffin-embedded (FFPE) tissue sections, visualized with a fluorescent microscope. Use in conjunction with the DISCOVERY HRP detection systems including DISCOVERY HQ HRP detection, OmniMap HRP detection, and UltraMap HRP detection kits, DISCOVERY series of instruments, and ancillary reagents for optimal performance. DISCOVERY Inhibitor is required for use with DISCOVERY Red 610 Kit and should be purchased separately.The following characteristics of the DISCOVERY Red 610 Kit are provided so that proper microscope settings can be used:Excitation wavelength: 580nm Emission wavelength: 625nmIf the DISCOVERY Red 610 kit is to be used in conjunction with other DISCOVERY fluors, it is recommended that a filter with the following specifications be used in order to minimize the amount of bleed through.Excitation: 580/25nmBeamsplitter: 600nmEmission: 625/30nm
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY mRNA DAB Detection Kit
    DISCOVERY mRNA DAB Detection Kit The DISCOVERY mRNA DAB Detection Kit is to be used with a third party Universal HRP Kit. It will enable researchers to stain their mRNA targets of interest with a DAB chromogen.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Teal HRP Kit
    DISCOVERY Teal HRP Kit The DISCOVERY Teal HRP Kit is a detection kit used to generate a teal chromogenic signal which can be visualized using a bright field light microscope. The DISCOVERY Teal HRP Kit was designed for chromogenic target localization through IHC or ISH in frozen sections or formalin-fixed, paraffin-embedded tissue sections, to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems conjugates and ancillary reagents for optimal performance.
    IVD For in vitro diagnostic use.
    CONFIRM anti-p53 (DO-7) Primary Antibody
    CONFIRM anti-p53 (DO-7) Primary Antibody CONFIRM anti-p53 (DO-7) Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of p53 protein by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpretedby a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    Country Specific Labeling See country-specific product labeling for regulatory status.
    HHV-8 (13B10) Mouse Monoclonal Antibody
    HHV-8 (13B10) Mouse Monoclonal Antibody HHV-8 Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the HHV-8 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY FAM Kit
    DISCOVERY FAM Kit The DISCOVERY FAM Kit was designed for fluorescent antigen localization in frozen sections or formalin-fixed, paraffin-embedded (FFPE) tissue sections, visualized with a fluorescent microscope. Use in conjunction with the DISCOVERY HRP detection systems including DISCOVERY HQ HRP detection, OmniMap HRP detection, and UltraMap HRP detection kits, DISCOVERY series of instruments, and ancillary reagents for optimal performance. DISCOVERY Inhibitor is required for use with DISCOVERY FAM Kit and should be purchased separately.The following characteristics of the DISCOVERY FAM Kit are provided so that proper microscope settings can be used: Excitation wavelength: 490nm Emission wavelength: 520nmIf the DISCOVERY FAM is to be used in conjunction with other DISCOVERY fluors, it is recommended that a filter with the following specifications be used in order to minimize the amount of bleed through.Excitation: 490/20nmBeamsplitter: 505nmEmission: 520/50nm
    IVD For in vitro diagnostic use.
    Oct-2 (MRQ-2) Mouse Monoclonal Antibody
    Oct-2 (MRQ-2) Mouse Monoclonal Antibody Oct-2 (MRQ-2) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the Oct-2 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Rhodamine 6G Kit
    DISCOVERY Rhodamine 6G Kit The DISCOVERY Rhodamine 6G Kit was designed for fluorescent antigen localization in frozen sections or formalin-fixed, paraffin-embedded (FFPE) tissue sections, visualized with a fluorescent microscope. Use in conjunction with the DISCOVERY HRP detection systems including DISCOVERY HQ HRP detection, OmniMap HRP detection, and UltraMap HRP detection kits, DISCOVERY series of instruments, and ancillary reagents for optimal performance. DISCOVERY Inhibitor is required for use with DISCOVERY Rhodamine 6G Kit and should be purchased separately.The following characteristics of the DISCOVERY Rhodamine 6G Kit are provided so that proper microscope settings can be used:Excitation wavelength: 546nm Emission wavelength: 572nmIf the DISCOVERY Rhodamine 6G kit is to be used in conjunction with other DISCOVERY fluors, it is recommended that a filter with the following specifications be used in order to minimize the amount of bleed through.Excitation: 546/10nmBeamsplitter: 556nmEmission: 572/23nm
    IVD For in vitro diagnostic use.
    MUC6 (MRQ-20) Mouse Monoclonal Antibody
    MUC6 (MRQ-20) Mouse Monoclonal Antibody MUC6 (MRQ-20) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the MUC6 protein in formalin-fixed, paraffin-embedded tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Calcitonin Rabbit Polyclonal Antibody
    Calcitonin Rabbit Polyclonal Antibody Calcitonin Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the calcitonin hormone in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-CD68 (KP-1) Primary Antibody
    CONFIRM anti-CD68 (KP-1) Primary Antibody CONFIRM anti-CD68 (KP-1) Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of CD68 by light microscopy in sections of formalin-fixed, paraffin- embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic use.
    IVD For in vitro diagnostic use.
    Calponin-1 (EP798Y) Rabbit Monoclonal Antibody
    Calponin-1 (EP798Y) Rabbit Monoclonal Antibody Calponin-1 (EP798Y) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the Calponin-1 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Cy5 Kit
    DISCOVERY Cy5 Kit The DISCOVERY Cy5 Kit was designed for fluorescent antigen localization in frozen sections or formalin-fixed, paraffin-embedded (FFPE) tissue sections, visualized with a fluorescent microscope. Use in conjunction with the DISCOVERY HRP detection systems including DISCOVERY HQ HRP detection, OmniMap HRP detection, and UltraMap HRP detection kits, DISCOVERY series of instruments, and ancillary reagents for optimal performance. DISCOVERY Inhibitor is required for use with DISCOVERY Cy5 Kit and should be purchased separately.The following characteristics of the DISCOVERY Cy5 Kit are provided so that proper microscope settings can be used:Excitation wavelength: 650nm Emission wavelength 670nm
    IVD For in vitro diagnostic use.
    Product image for the VENTANA HE 600 system
    VENTANA HE 600 system Optimize efficiency and stain quality with the automated VENTANA HE 600 pathology laboratory staining system.
    IVD For in vitro diagnostic use.
    IgD Rabbit Polyclonal Antibody
    IgD Rabbit Polyclonal Antibody IgD Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of IgD in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Glucagon Rabbit Polyclonal Antibody
    Glucagon Rabbit Polyclonal Antibody Glucagon Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the glucagon hormone in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    GH Rabbit Polyclonal Antibody
    GH Rabbit Polyclonal Antibody GH (Growth Hormone) Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the growth hormone in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    ASR Analyte Specific Reagent. Analytical and performance characteristics are not established.
    Lambda DNP Probe (664-693)
    Lambda DNP Probe (664-693) Analyte Specific Reagent. Analytical and performance characteristics are not established.Ventana Medical Systems (Ventana) Lambda DNP Probe (664-693) is designed to bind to Lambda light chain mRNA. The probe sequenced is complementary to the Lambda mRNA sequence: 5’CACAGAAGCUACAGCUGCCAGGUCACGCAU3’.
    IVD For in vitro diagnostic use.
    LH Rabbit Polyclonal Antibody
    LH Rabbit Polyclonal Antibody LH Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the LH glycoprotein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    ASR Analyte Specific Reagent. Analytical and performance characteristics are not established.
    Lambda DNP Probe (704-733)
    Lambda DNP Probe (704-733) Analyte Specific Reagent. Analytical and performance characteristics are not established.Ventana Medical Systems (Ventana) Lambda DNP Probe (704-733) is designed to bind to Lambda light chain mRNA. The probe sequence is complementary to the Lambda mRNA sequence: 5’CCGUGGAGAAGACAGUGGCCCCUACAGAAU3’.
    IVD For in vitro diagnostic use.
    CONFIRM anti-Lambda Rabbit Polyclonal Primary Antibody
    CONFIRM anti-Lambda Rabbit Polyclonal Primary Antibody Polyclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of the Lambda light chain protein by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    ASR Analyte Specific Reagent. Analytical and performance characteristics are not established.
    Lambda DNP Probe (826-855)
    Lambda DNP Probe (826-855) Analyte Specific Reagent. Analytical and performance characteristics are not established.Ventana Medical Systems (Ventana) Lambda DNP Probe (826-855) is designed to bind to Lambda light chain mRNA. The probe is complementary to the Lambda mRNA sequence: 5’GCCCUUCUCCCUGCACUCAAUAAACCCUCA3’.
    ASR Analyte Specific Reagent. Analytical and performance characteristics are not established.
    Lambda DNP Probe (768-797)
    Lambda DNP Probe (768-797) Analyte Specific Reagent. Analytical and performance characteristics are not established.Ventana Medical Systems (Ventana) Lambda DNP Probe (768-797) is designed to bind to Lambda light chain mRNA. The probe sequence is complementary to the Lambda mRNA sequence: 5’GAGACUAGAGCUGCAGGAUCCCAGGGGAGG3’.
    IVD For in vitro diagnostic use.
    Myogenin (F5D) Mouse Monoclonal Antibody
    Myogenin (F5D) Mouse Monoclonal Antibody Myogenin (F5D) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the myogenin protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    SF-1 (EP434) Rabbit Monoclonal Primary Antibody
    SF-1 (EP434) Rabbit Monoclonal Primary Antibody SF-1 (EP434) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the steroidogenic factor-1 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    SATB2 (EP281) Rabbit Monoclonal Antibody
    SATB2 (EP281) Rabbit Monoclonal Antibody SATB2 (EP281) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the SATB2 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CA19-9 (121SLE) Mouse Monoclonal Antibody
    CA19-9 (121SLE) Mouse Monoclonal Antibody CA19-9 (121SLE) Mouse Monoclonal Antibody is intended for laboratory use in the detection of the CA19-9 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    INFORM Cytoplasmic Lambda mRNA Probe
    INFORM Cytoplasmic Lambda mRNA Probe INFORM Cytoplasmic Lambda mRNA Probe is intended for laboratory use in the qualitative in situ hybridization-based detection of Lambda light chain mRNA by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Cytokeratin 19 (A53-B/A2.26) Mouse Monoclonal Antibody
    Cytokeratin 19 (A53-B/A2.26) Mouse Monoclonal Antibody Cytokeratin 19 (A53-B/A2.26) Mouse Monoclonal Antibody is intended for laboratory use in the detection of the Cytokeratin 19 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-C4d (SP91) Rabbit Monoclonal Primary Antibody
    anti-C4d (SP91) Rabbit Monoclonal Primary Antibody C4d (SP91) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the C4d protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    C3d Rabbit Polyclonal Antibody
    C3d Rabbit Polyclonal Antibody C3d Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the C3d protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    ASR Analyte Specific Reagent. Analytical and performance characteristics are not established.
    Kappa DNP Probe (495-524)
    Kappa DNP Probe (495-524) Ventana Medical Systems (Ventana) Kappa DNP Probe (495-524) is designed to bind to kappa light chain mRNA. The probe sequence is complementary to the Kappa mRNA sequence: 5’UGCCUCUGUUGUGUGCCUGCUGAAUAACUU3’.
    IVD For in vitro diagnostic use.
    CONFIRM anti-Kappa Rabbit Polyclonal Primary Antibody
    CONFIRM anti-Kappa Rabbit Polyclonal Primary Antibody CONFIRM anti-Kappa Rabbit Polyclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of the Kappa light chain protein by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    ASR Analyte Specific Reagent. Analytical and performance characteristics are not established.
    Kappa DNP Probe (637-666)
    Kappa DNP Probe (637-666) Ventana Medical Systems (Ventana) Kappa DNP Probe (637-666) is designed to bind to kappa light chain mRNA. The probe sequence is complementary to the Kappa mRNA sequence: 5’AGCACCCUGACGCUGAGCAAAGCAGACUAC3’.
    ASR Analyte Specific Reagent. Analytical and performance characteristics are not established.
    Kappa DNP Probe (597-626)
    Kappa DNP Probe (597-626) Ventana Medical Systems (Ventana) Kappa DNP Probe (597-626) is designed to bind to kappa light chain mRNA. The probe sequence is complementary to the Kappa mRNA sequence: 5’CACAGAGCAGGACAGCAAGGACAGCACCUA3’
    ASR Analyte Specific Reagent. Analytical and performance characteristics are not established.
    Kappa DNP Probe (538-567)
    Kappa DNP Probe (538-567) Ventana Medical Systems (Ventana) Kappa DNP Probe (538-567) is designed to bind to kappa light chain mRNA. The probe sequence is complementary to the Kappa mRNA sequence: 5’GCCAAAGUACAGUGGAAGGUGGAUAACGCC3’.
    IVD For in vitro diagnostic use.
    INFORM Kappa Probe
    INFORM Kappa Probe INFORM Kappa Probe is intended for laboratory use in the qualitative in situ hybridization-based detection of Kappa light chain mRNA by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    hCG Rabbit Polyclonal Antibody
    hCG Rabbit Polyclonal Antibody hCG Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of hCG (human chorionic gonadotropin) in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Herpes Simplex Virus 1 (10A3) Mouse Monoclonal Antibody
    Herpes Simplex Virus 1 (10A3) Mouse Monoclonal Antibody Herpes Simplex Virus I (10A3) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the Herpes Simplex Virus I in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Anti-PRAME (EPR20330) Rabbit Monoclonal Primary Antibody
    anti-PRAME (EPR20330) Rabbit Monoclonal Primary Antibody PRAME (PReferentially expressed Antigen in MElanoma) is a tumor biomarker expressed in most cutaneous and ocular melanomas.
    IVD For in vitro diagnostic use.
    Adenovirus (2/6 &amp; 20/11) Mouse Monoclonal Primary Antibody
    Adenovirus (2/6 & 20/11) Mouse Monoclonal Primary Antibody Adenovirus (20/11 & 2/6) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of Adenovirus in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    IgA Rabbit Polyclonal Antibody
    IgA Rabbit Polyclonal Antibody IgA Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of IgA in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    IgM Rabbit Polyclonal Antibody
    IgM Rabbit Polyclonal Antibody IgM Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of IgM in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    PLAP (NB10) Mouse Monoclonal Antibody
    PLAP (NB10) Mouse Monoclonal Antibody PLAP (NB10) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the PLAP protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use
    IVD For in vitro diagnostic use.
    Prolactin Rabbit Polyclonal Antibody
    Prolactin Rabbit Polyclonal Antibody Prolactin Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the prolactin protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Amp Clear
    DISCOVERY Amp Clear DISCOVERY Amp Clear is a high ionic strength polymeric reagent designed for the blocking of non-specific binding of antibodies during immunohistochemical (IHC) and in situ hybridization (ISH) protocols on the DISCOVERY series of instruments. It can be used at any blocking step in a procedure. DISCOVERY Amp Clear should be used when amplified signal achieved using Amp-HQ or Amp-BF is too diffuse. The ability for DISCOVERY Amp Clear to produce a more discrete amplified signal occurs when DISCOVERY Amp Clear co- incubates with any HRP conjugate.
    IVD For in vitro diagnostic use.
    anti-CD8 (SP239) Rabbit Monoclonal Primary Antibody
    anti-CD8 (SP239) Rabbit Monoclonal Primary Antibody Anti-CD8 (SP239) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of CD8 by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    VENTANA<sup>®</sup> FGFR2b (FPR2-D) Mouse Monoclonal Antibody
    VENTANA® FGFR2b (FPR2-D) Mouse Monoclonal Antibody RUO FGFR2b is a tyrosine kinase located in the membrane and functions as a receptor for proteins from the FGF family.1,2VENTANA FGFR2b (FPR2-D) Mouse Monoclonal Antibody is an immunohistochemical assay that utilizes, a mouse monoclonal primary antibody (clone FPR2-D) for the detection of Fibroblast Growth Factor Receptor type 2b (FGFR2b) proteins, producing membranous staining in formalin-fixed, paraffin-embedded (FFPE) tissue. The specific antibody is visualized using OptiView DAB IHC Detection Kit (Cat. No. 760-700 / 06396500001) on a BenchMark IHC/ISH instrument. Refer to the respective method sheet for further information.1. Eswarakumar VP, Lax I, Schlessinger J. Cellular signaling by fibroblast growth factor receptors. Cytokine Growth Factor Rev. 2005;16(2):139-1492. Jaye M, Schlessinger J, Dionne CA. Fibroblast growth factor receptor tyrosine kinases: molecular analysis and signal transduction. Biochim Biophys Acta. 1992;1135(2):185-199.
    IVD For in vitro diagnostic use.
    HER2-4B5-cdx-stain
    VENTANA® HER2 (4B5) Rabbit Monoclonal Primary Antibody RxDx CE-IVD VENTANA HER2 (4B5) Rabbit Monoclonal Primary Antibody RxDx - Building on the same proven technology of the widely adopted HER2 (4B5) assay, Roche has delivered the only test approved to identify HER2-low breast cancer patients - helping match even more women with highly effective personalised therapies.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY anti-DIG HRP Multimer (RUO)
    DISCOVERY anti-DIG HRP Multimer (RUO) DISCOVERY anti-DIG HRP Multimer (RUO) is an anti-DIG antibody conjugate labeled with HRP to be used with any HRP substrate to detect DIG labeled probes.DISCOVERY anti-DIG HRP Multimer (RUO) is designed to be used in conjunction with the DISCOVERY XT and DISCOVERY ULTRA (DISCOVERY series) instruments and VENTANA ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY anti-Rabbit HQ
    DISCOVERY anti-Rabbit HQ DISCOVERY anti-Rabbit HQ is a hapten labeled conjugate to be detected by DISCOVERY anti-HQ HRP. It consists of a robust chemistry that provides clean background in combination with enhanced specificity and sensitivity, which increases the signal-to-noise ratio.DISCOVERY anti-Rabbit HQ is designed to be used in conjunction with the DISCOVERY XT and DISCOVERY ULTRA (DISCOVERY series) instruments and VENTANA ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY anti-BF HRP
    DISCOVERY anti-BF HRP DISCOVERY anti-BF HRP is designed to be used in conjunction with the DISCOVERY Amp BF Kit, and chromogenic (such as ChromoMAP DAB or DISCOVERY Purple) or fluorescent (such as DISCOVERY FITC) HRP substrate kits to allow the detection of lower copy number molecules or low expressing antigens on the DISCOVERY series of instruments. BF is a bio-orthogonal hapten and will not cross react with any endogenous proteins in the tissue.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Silver Kit (RUO)
    DISCOVERY Silver Kit (RUO) The DISCOVERY Silver Kit was designed for chromogenic antigen localization in frozen sections or formalin-fixed, paraffin-embedded tissue sections, to be used in conjunction with the Discovery series of instruments and Ventana Medical Systems’ conjugates and ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY mRNA RED Detection Kit
    DISCOVERY mRNA RED Detection Kit The DISCOVERY mRNA Red Detection Kit is to be used with a third party Universal Kit. It will enable researchers to stain mRNA targets of interest with a Red chromogen.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY anti-Mouse HQ
    DISCOVERY anti-Mouse HQ DISCOVERY anti-Mouse HQ is a hapten-labeled conjugate to be detected by DISCOVERY anti-HQ HRP. It consists of a robust chemistry that provides clean background in combination with enhanced specificity and sensitivity, which increases the signal-to-noise ratio.DISCOVERY anti-Mouse HQ is designed to be used in conjunction with the DISCOVERY XT and DISCOVERY ULTRA (DISCOVERY series) instruments and VENTANA ancillary reagents for optimal performance.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> PTEN (SP218) Rabbit Monoclonal Primary Antibody
    VENTANA® PTEN (SP218) Rabbit Monoclonal Primary Antibody VENTANA PTEN (SP218) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of the phosphatase and tensin homolog (PTEN) protein by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> pan-TRK (EPR17341) Assay
    VENTANA® pan-TRK (EPR17341) Assay VENTANA pan-TRK (EPR17341) Assay is intended for laboratory use in the qualitative immunohistochemical detection of the C-terminal region of the tropomyosin receptor kinase (TRK) proteins A, B and C by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> PD-L1 (SP263) Rabbit Monoclonal Primary Antibody
    VENTANA® PD-L1 (SP263) Rabbit Monoclonal Primary Antibody VENTANA PD-L1 (SP263) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the PD-L1 protein in formalin-fixed, paraffin-embedded (FFPE) tissue. It is intended to be stained with BenchMark IHC/ISH instruments. It is indicated as an aid in the assessment of PD-L1 expression in human tissues.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> HA Assay
    VENTANA® HA Assay VENTANA HA Assay is intended for laboratory use in the detection of hyaluronan in sections of formalin-fixed, paraffin-embedded tissue when stained on BenchMark IHC/ISH instruments using the OptiView DAB IHC Detection Kit and target retrieval with Protease 1.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> anti-ALK (D5F3) Rabbit Monoclonal Primary Antibody
    VENTANA® anti-ALK (D5F3) Rabbit Monoclonal Primary Antibody Japan and Korea VENTANA anti-ALK (D5F3) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative detection of the anaplastic lymphoma kinase (ALK) protein in formalin-fixed, paraffin-embedded nonsmall cell lung carcinoma (NSCLC) tissue stained on a BenchMark IHC/ISH instrument. It is indicated as an aid in identifying patients eligible for treatment with XALKORI® (crizotinib), ZYKADIA® (ceritinib), ALECENSA® (alectinib), ALUNBRIG® (brigatinib) or lorlatinib.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> anti-ALK (D5F3) Rabbit Monoclonal Primary Antibody
    VENTANA® anti-ALK (D5F3) Rabbit Monoclonal Primary Antibody ROW VENTANA anti-ALK (D5F3) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative detection of the anaplastic lymphoma kinase (ALK) protein in formalin-fixed, paraffin-embedded non-small cell lung carcinoma (NSCLC) tissue stained with the BenchMark IHC/ISH instruments. It is indicated as an aid in identifying patients eligible for treatment with XALKORI® (crizotinib), ZYKADIA® (ceritinib) or ALECENSA® (alectinib).This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-Vimentin (V9) Primary Antibody
    CONFIRM anti-Vimentin (V9) Primary Antibody CONFIRM anti-Vimentin (V9) Primary Antibody is intended for laboratory use in thequalitative immunohistochemical detection of vimentin by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and propper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> TFF3 (7F1.21) Mouse Monoclonal Primary Antibody
    VENTANA® TFF3 (7F1.21) Mouse Monoclonal Primary Antibody The VENTANA TFF3 (7F1.21) Mouse Monoclonal Primary Antibody (VENTANA TFF3 (7F1.21)) is directed against a cytoplasmic epitope of the trefoil factor family 3 (TFF3) protein present in epithelial cells. This antibody may be used to aid in the identification of intestinal metaplasia (IM) of the esophagus. The antibody is intended for qualitative staining in sections of fixed, paraffin-embedded clinical samples stained with a BenchMark ULTRA automated staining instrument.The clinical interpretation of any staining, or the absence of staining, must be complemented by histological/cytological studies and evaluation of proper controls. Evaluation must be made by a qualified pathologist within the context of the patient’s clinical history and other diagnostic tests.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-Total c-MET (SP44) Rabbit Monoclonal Primary Antibody
    CONFIRM anti-Total c-MET (SP44) Rabbit Monoclonal Primary Antibody Ventana Medical Systems' (Ventana) CONFIRM anti-Total c-MET (SP44) Rabbit Monoclonal Primary Antibody is directed against a membranous and/or cytoplasmic epitope present in human normal epithelial or tumor cells. This antibody may be used to aid in the identification of normal and neoplastic c-MET expressing cells. The antibody is intended for qualitative staining in sections of formalin fixed, paraffin embedded tissue.The clinical interpretation of any staining, or the absence of staining, must be complemented by histological studies and evaluation of proper controls. Evaluation must be made by a qualified pathologist within the context of the patient’s clinical history and other diagnostic tests.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> DLL3 (SP347) RxDx Assay
    VENTANA® DLL3 (SP347) RxDx Assay VENTANA DLL3 (SP347) RxDx Assay is intended for the qualitative detection of Delta-like protein 3 (DLL3) in formalin-fixed, paraffin-embedded (FFPE) small cell lung cancer (SCLC) tissue stained with a VENTANA BenchMark ULTRA instrument. It is indicated as an aid in identifying patients eligible for treatment with rovalpituzumab tesirine.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.CAUTION: Investigational device. Limited by Federal (or United States) law to investigational use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> DLL3 (SP347) Assay
    VENTANA® DLL3 (SP347) Assay VENTANA DLL3 (SP347) Assay (DLL3 (SP347) Assay) is intended for laboratory use in the detection of Delta-like protein 3 (DLL3) in sections of formalin-fixed, paraffin-embedded (FFPE) tissue when stained on BenchMark IHC/ISH instruments using the OptiView DAB IHC Detection Kit.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> ROS1 (SP384) Rabbit Monoclonal Primary Antibody
    VENTANA® ROS1 (SP384) Rabbit Monoclonal Primary Antibody VENTANA ROS1 (SP384) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative detection of ROS1 protein in formalin-fixed, paraffin-embedded tissue stained with VENTANA BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use. 
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> MSLN (SP74) Dx ASSAY
    VENTANA® MSLN (SP74) Dx ASSAY VENTANA MSLN (SP74) Assay is intended for the immunohistochemical assessment of the mesothelin protein in formalin-fixed, paraffin-embedded (FFPE) tissue stained with BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> CLDN18 (43-14A) Assay
    VENTANA® CLDN18 (43-14A) Assay VENTANA CLDN18 (43-14A) Assay is intended for the immunohistochemical detection of the Claudin 18 (CLDN18) protein in formalin-fixed, paraffinembedded (FFPE) neoplastic tissues stained with BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY ULTRA
    DISCOVERY ULTRA The DISCOVERY ULTRA Research Staining System is intended to automatically stain histological or cytological specimens on microscope slides with specific immunohistochemistry or in situ hybridization reagents for research use only. Evolved from the DISCOVERY series of instruments, the DISCOVERY ULTRA instrument fully automates the processes of baking, deparaffinization, and staining.
    IVD For in vitro diagnostic use.
    anti-Androgen Receptor (SP107) Rabbit Monoclonal Primary Antibody
    anti-Androgen Receptor (SP107) Rabbit Monoclonal Primary Antibody Androgen Receptor (SP107) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of androgen receptor in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA FOLR1 (FOLR-2.1) RxDx Assay
    VENTANA® FOLR1 (FOLR1-2.1) RxDx Assay Predictive IHC assay, FDA First IHC companion diagnostic for determining folate receptor alpha (FRɑ) protein expression in EOC patients who may benefit from ELAHERE™ (mirvetuximab soravtansine)
    IVD For in vitro diagnostic use.
    WT1 (6F-H2) Mouse Monoclonal Antibody
    WT1 (6F-H2) Mouse Monoclonal Antibody WT1 (6F-H2) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the WT1 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Special Stains Van Gieson CS
    Special Stains Van Gieson CS Special Stains Van Gieson CS used in conjunction with Elastic Stain Core Kit is intended for laboratory use in staining non-target tissue components and providing contrast with target stains in sections of formalin-fixed, paraffin-embedded (FFPE) tissue stained on a BenchMark Special Stains instrument. This reagent is intended as a counterstain in special stains applications. This product is intended for in vitro diagnostic (IVD) use. 
    IVD For in vitro diagnostic use.
    Caldesmon (E89) Rabbit Monoclonal Antibody
    Caldesmon (E89) Rabbit Monoclonal Antibody Caldesmon (E89) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the Caldesmon protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-Calcitonin (SP17) Rabbit Monoclonal Primary Antibody
    anti-Calcitonin (SP17) Rabbit Monoclonal Primary Antibody Calcitonin (SP17) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the Calcitonin polypeptide in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-CD7 (SP94) Rabbit Monoclonal Primary Antibody
    anti-CD7 (SP94) Rabbit Monoclonal Primary Antibody Anti-CD7(SP94) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of CD7 by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> anti-PMS2 (A16-4) Mouse Monoclonal Primary Antibody
    VENTANA® anti-PMS2 (A16-4) Mouse Monoclonal Primary Antibody For use with VENTANA MMR RxDx Panel and the VENTANA MMR IHC Panel, US-FDA
    IVD For in vitro diagnostic use.
    Annexin A1 (MRQ-3) Mouse Monoclonal Antibody
    Annexin A1 (MRQ-3) Mouse Monoclonal Antibody Annexin A1 (MRQ-3) MouseMonoclonal Primary Antibody is intended for laboratory use in the detection of the Annexin A1 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Inhibin, alpha (MRQ-63) Rabbit Monoclonal Antibody
    Inhibin, alpha (MRQ-63) Rabbit Monoclonal Antibody Inhibin, alpha (MRQ-63) Rabbit Monoclonal Antibody is intended for laboratory use in the detection of the Inhibin, alpha protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Villin (CWWB1) Mouse Monoclonal Antibody
    Villin (CWWB1) Mouse Monoclonal Antibody Villin (CWWB1) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the villin glycoprotein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Napsin A (MRQ-60) Mouse Monoclonal Primary Antibody
    Napsin A (MRQ-60) Mouse Monoclonal Primary Antibody Napsin A (MRQ-60) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the Napsin A protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    TRAcP (9C5) Mouse Monoclonal Antibody
    TRAcP (9C5) Mouse Monoclonal Antibody TRAcP (9C5) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the TRAcP glycoprotein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-Thyroid Transcription Factor-1 (SP141) Rabbit Monoclonal Primary Antibody
    anti-Thyroid Transcription Factor-1 (SP141) Rabbit Monoclonal Primary Antibody Anti-Thyroid Transcription Factor-1 (SP141) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of  thyroid transcription factor-1 (TTF-1) by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Epstein-Barr Virus (CS1-4) Mouse Monoclonal Antibody
    Epstein-Barr Virus (CS1-4) Mouse Monoclonal Antibody Epstein-Barr Virus (CS1-4) Mouse Monoclonal Primary Antibody is intended for laboratoryuse in the detection of the Epstein-Barr Virus in formalin-fixed, paraffin-embedded tissuestained on VENTANA BenchMark IHC/ISH instruments. This product should be interpretedby a qualified pathologist in conjunction with histological examination, relevant clinicalinformation, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> anti-MSH6 (SP93) Rabbit Monoclonal Primary Antibody
    VENTANA® anti-MSH6 (SP93) Rabbit Monoclonal Primary Antibody For use with VENTANA MMR RxDx Panel and the VENTANA MMR IHC Panel, US-FDA
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> anti-MLH1 (M1) Mouse Monoclonal Primary Antibody
    VENTANA® anti-MLH1 (M1) Mouse Monoclonal Primary Antibody For use with VENTANA MMR RxDx Panel and the VENTANA MMR IHC Panel, US-FDA
    IVD For in vitro diagnostic use.
    MUM1 (EP190) Rabbit Monoclonal Antibody
    MUM1 (EP190) Rabbit Monoclonal Antibody MUM1 (EP190) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the MUM1 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    MUC5AC (MRQ-19) Mouse Monoclonal Antibody
    MUC5AC (MRQ-19) Mouse Monoclonal Antibody MUC5AC (MRQ-19) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the MUC5AC protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> anti-MSH2 (G219-1129) Mouse Monoclonal Primary Antibody
    VENTANA® anti-MSH2 (G219-1129) Mouse Monoclonal Primary Antibody For use with VENTANA MMR RxDx Panel and the VENTANA MMR IHC Panel, US-FDA
    IVD For in vitro diagnostic use.
    SOX-10 (SP267) Rabbit Monoclonal Primary Antibody
    SOX-10 (SP267) Rabbit Monoclonal Primary Antibody SOX-10 (SP267) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the SOX-10 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Carbonic Anhydrase IX (CA IX) (EP161) Rabbit Monoclonal Antibody
    Carbonic Anhydrase IX (CA IX) (EP161) Rabbit Monoclonal Antibody Carbonic Anhydrase IX (EP161) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the Carbonic Anhydrase IX protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-CD38 (SP149) Rabbit Monoclonal Primary Antibody
    anti-CD38 (SP149) Rabbit Monoclonal Primary Antibody CD38 (SP149) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the CD38 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-CD117 (EP10) Rabbit Monoclonal Primary Antibody
    anti-CD117 (EP10) Rabbit Monoclonal Primary Antibody Anti-CD117 (EP10) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of CD117 protein by light microscopy in sections of formalin-fixed, paraffin- embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CEA (CEA31) Mouse Monoclonal Antibody
    CEA (CEA31) Mouse Monoclonal Antibody CEA (CEA31) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the CEA glycoprotein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Glial Fibrillary Acidic Protein (EP672Y) Rabbit Monoclonal Antibody
    Glial Fibrillary Acidic Protein (EP672Y) Rabbit Monoclonal Antibody Glial Fibrillary Acidic Protein (EP672Y) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the Glial Fibrillary Acidic Protein in formalin-fixed, paraffinembedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    ASR Analyte Specific Reagent. Analytical and performance characteristics are not established.
    HPV 18 mRNA Probe
    HPV 18 mRNA Probe Ventana Medical Systems (Ventana) HPV 18 mRNA Probe is intended for use as a raw material in Laboratory Developed Tests (LDTs). The HPV 18 mRNA probe is a DNP hapten labeled probe designed to bind to the HPV 18 E6/E7 mRNA transcript. The probe has affinity to the HPV 18 genotype with no known cross reactivity to other common HPV genotypes.Depending on the conditions used within a laboratory developed test, cross reactivity to the complementary HPV 18 DNA sequence may occur.In the U.S., Analyte Specific Reagent. Analytical and performance characteristics are not established.
    IVD For in vitro diagnostic use.
    <i>ultra</i>View SISH DNP Detection Kit
    ultraView SISH DNP Detection Kit CE-IVD Ventana Medical Systems Inc’s, (Ventana) ultraView SISH DNP Detection Kit is an indirect, biotin-free system for detecting DNP labeled probes. The kit is intended to identify targets by silver in situ hybridization (ISH) in sections of formalin fixed, paraffin embedded tissue that are stained on BenchMark IHC/ISH instruments.The clinical interpretation of any staining, or the absence of staining, must be complemented by histological examination and evaluation of proper controls. Evaluation must be made by a qualified reader within the context of the patient’s clinical history and other diagnostic tests.This detection kit is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    FOXA1 (2F83) Mouse Monoclonal Primary Antibody
    FOXA1 (2F83) Mouse Monoclonal Primary Antibody FOXA1 (2F83) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the FOXA1 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-Synaptophysin (SP11) Rabbit Monoclonal Primary Antibody
    CONFIRM anti-Synaptophysin (SP11) Rabbit Monoclonal Primary Antibody CONFIRM anti-Synaptophysin (SP11) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of synaptophysin by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-S100 (4C4.9) Primary Antibody
    CONFIRM anti-S100 (4C4.9) Primary Antibody CONFIRM anti-S100 (4C4.9) Primary Antibody is a mouse monoclonal antibody intended for laboratory use  in the qualitative immunohistochemical detection of S100 protein by light microscopy in sections of formalin-fixed, paraffin-embedded tissue on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.   
    IVD For in vitro diagnostic use.
    CD45 (LCA)(2B11 &amp; PD7/26) Mouse Monoclonal Antibody
    CD45 (LCA)(2B11 & PD7/26) Mouse Monoclonal Antibody CD45 (LCA) (2B11 & PD7/26) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the CD45 (LCA) protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CA-125 (OC125) Mouse Monoclonal Antibody
    CA-125 (OC125) Mouse Monoclonal Antibody CA 125 (OC125) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the CA 125 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Spectrin (RBC2/3D5) Mouse Monoclonal Antibody
    Spectrin (RBC2/3D5) Mouse Monoclonal Antibody Spectrin (RBC2/3D5) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the spectrin protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-CD56 (123C3) Mouse Monoclonal Primary Antibody
    CONFIRM anti-CD56 (123C3) Mouse Monoclonal Primary Antibody Ventana Medical Systems’ (Ventana) CONFIRM anti-CD56 (123C3) Mouse Monoclonal Primary Antibody (CONFIRM anti-CD56 (123C3)) is directed against the CD56 molecule or neural cell adhesion molecule expressed by most neuroectodermally derived cell lines, tissues and neoplasms. It is also expressed on some mesodermally derived tumors, on natural killer cells, and NK cell lymphomas. This antibody exhibits a membrane/cytoplasmic staining pattern and may be used to aid in the identification of small cell carcinomas, neuroblastoma, and rhabdomyosarcoma. The antibody is intended for qualitative staining in sections of formalin fixed, paraffin embedded tissue.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    PSA (ER-PR8) Mouse Monoclonal Antibody
    PSA (ER-PR8) Mouse Monoclonal Antibody IVD This antibody is intended for in vitro diagnostic (IVD) use.The Cell Marque PSA (ER-PR8) antibody is intended for qualified laboratories to qualitatively identify by light microscopy the presence of associated antigens in sections of formalin-fixed, paraffin-embedded tissue sections using IHC test methods. Use of this antibody is indicated, subsequent to clinical differential diagnosis, as an aid in the identification of prostatic adenocarcinoma within the context of an antibody panel, the patient’s clinical history, and other diagnostic tests evaluated by a qualified pathologist.
    IVD For in vitro diagnostic use.
    VENTANA PD-L1 SP142 Assay
    VENTANA® PD-L1 (SP142) Assay US-FDA VENTANA PD-L1 (SP142) Assay is intended for the qualitative immunohistochemical assessment of the programmed death ligand 1 (PD-L1) protein.
    IVD For in vitro diagnostic use.
    p27<sup>Kip1</sup> (SX53G8) Mouse Monoclonal Antibody
    p27Kip1 (SX53G8) Mouse Monoclonal Antibody p27Kip1 (SX53G8) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the p27Kip1 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    FITC Anti-Kappa Primary Antibody
    FITC Anti-Kappa Primary Antibody FITC anti-Kappa Primary Antibody is a polyclonal antibody labeled with fluorescein. It is intended for laboratory use in the qualitative immunofluorescent detection of kappa immunoglobulin light chains by fluorescence microscopy in sections of frozen tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    FITC Anti-Albumin Primary Antibody
    FITC Anti-Albumin Primary Antibody This antibody is intended for in vitro diagnostic (IVD) use.Ventana® Medical Systems’ (Ventana) Systems FITC anti-Albumin Primary Antibody is a goat derived polyclonal antibody labeled with fluorescein and specifically directed against human albumin. This reagent should be used in conjunction with a panel of antibodies to aid in the identification of human albumin in target tissue (e.g., in the diagnosis of renal or dermal pathologies). FITC anti-Albumin is intended for laboratory use to qualitatively stain sections of frozen tissue on a Ventana automated slide stainer.The clinical interpretation of any staining, or the absence of staining, must be complemented by morphological studies and evaluation of proper controls. Evaluation must be made by a qualified pathologist within the context of the patient’s clinical history and other diagnostic tests. Prescription only.
    IVD For in vitro diagnostic use.
    FITC Anti-IgA Primary Antibody
    FITC Anti-IgA Primary Antibody FITC Anti-IgA Primary Antibody is a polyclonal antibody labeled with fluorescein. It is intended for laboratory use in the qualitative immunofluorescent detection of IgA by fluorescence microscopy in sections of frozen tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD).
    IVD For in vitro diagnostic use.
    FITC Anti-IgM Primary Antibody
    FITC Anti-IgM Primary Antibody FITC Anti-IgM Primary Antibody is a polyclonal antibody labeled with fluorescein. It is intended for laboratory use in the qualitative immunofluorescent detection of IgM by fluorescence microscopy in sections of frozen tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    FITC Anti-IgG Primary Antibody
    FITC Anti-IgG Primary Antibody FITC Anti-IgG Primary Antibody is a polyclonal antibody labeled with fluorescein. It is intended for laboratory use in the qualitative immunofluorescent detection of IgG by fluorescence microscopy in sections of frozen tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    FITC Anti-Fibrinogen Primary Antibody
    FITC Anti-Fibrinogen Primary Antibody FITC Anti-Fibrinogen Primary Antibody is a polyclonal antibody labeled with fluorescein. It is intended for laboratory use in the qualitative immunofluorescent detection of fibrinogen by fluorescence microscopy in sections of frozen tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    FITC Anti-Lambda Primary Antibody
    FITC Anti-Lambda Primary Antibody This antibody is intended for in vitro diagnostic (IVD) use.Ventana® Medical Systems’ (Ventana) Systems FITC anti-Lambda Primary Antibody is a burro derived polyclonal antibody labeled with fluorescein and specifically directed against human lambda light chains. This reagent should be used in conjunction with a panel of antibodies to aid in the identification of lambda light chains in target tissue (e.g., in the diagnosis of renal or dermal pathologies). FITC anti-Lambda is intended for laboratory use to qualitatively stain sections of frozen tissue on a Ventana automated slide stainer.The clinical interpretation of any staining, or the absence of staining, must be complemented by morphological studies and evaluation of proper controls. Evaluation must be made by a qualified pathologist within the context of the patient’s clinical history and other diagnostic tests. Prescription only.
    IVD For in vitro diagnostic use.
    FITC Anti-C3 Primary Antibody
    FITC Anti-C3 Primary Antibody FITC Anti-C3 Primary Antibody is a polyclonal antibody labeled with fluorescein. It is intended for laboratory use in the qualitative immunofluorescent detection of C3 by fluorescence microscopy in sections of frozen tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD).
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY ChromoMap Blue Kit (RUO)
    DISCOVERY ChromoMap Blue Kit (RUO) Biotin-free NBT/BCIP Detection Kit for the Ventana DISCOVERY Series of Instruments The ChromoMap Blue Kit was designed for biotin-free antigen localization in frozen sections or formalin-fixed, paraffin-embedded tissue sections, to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ ancillary reagents for optimal performance.
    IVD For in vitro diagnostic use.
    FITC Anti-C1q Primary Antibody
    FITC Anti-C1q Primary Antibody FITC Anti-C1q Primary Antibody is a polyclonal antibody labeled with fluorescein. It is intended for laboratory use in the qualitative immunofluorescent detection of C1q by fluorescence microscopy in sections of frozen tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    GCDFP-15 (EP1582Y) Rabbit Monoclonal Antibody
    GCDFP-15 (EP1582Y) Rabbit Monoclonal Antibody GCDFP-15 (EP1582Y) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the GCDFP-15 glycoprotein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    GATA3 (L50-823) Mouse Monoclonal Antibody
    GATA3 (L50-823) Mouse Monoclonal Antibody GATA3 (L50-823) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the GATA3 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Glutamine Synthetase (GS-6) Mouse Monoclonal Antibody
    Glutamine Synthetase (GS-6) Mouse Monoclonal Antibody Glutamine Synthetase (GS-6) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the glutamine synthetase enzyme in formalin-fixed, paraffinembedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Elastic Stain Core Kit
    Elastic Stain Core Kit Elastic Stain Core Kit, used in conjunction with Special Stains Van Gieson CS is intended for laboratory use as a qualitative histologic stain to demonstrate elastic fibers by light microscopy in sections of formalin-fixed, paraffin-embedded (FFPE) tissue stained on a BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use. 
    IVD For in vitro diagnostic use.
    Synaptophysin (MRQ-40) Rabbit Monoclonal Antibody
    Synaptophysin (MRQ-40) Rabbit Monoclonal Antibody Synaptophysin (MRQ-40) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the Synaptophysin glycoprotein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CD1a (EP3622) Rabbit Monoclonal Antibody
    CD1a (EP3622) Rabbit Monoclonal Antibody CD1a (EP3622) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the CD1a glycoprotein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CDX-2 (EPR2764Y) Rabbit Monoclonal Antibody
    CDX-2 (EPR2764Y) Rabbit Monoclonal Antibody CDX-2 (EPR2764Y) Rabbit Monoclonal Antibody is intended for laboratory use in the detection of the CDX-2 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CINtec<sup>®</sup> p16 Histology
    CINtec® p16 Histology Japan CINtec p16 Histology is an immunohistochemistry assay for the qualitative detection of the p16INK4a protein on formalin-fixed, paraffin-embedded tissue sections prepared from cervical biopsies. It is indicated to be used in conjunction with H&E stained slides prepared from the same cervical tissue specimen as an aid to increase diagnostic accuracy and interobserver agreement in the diagnosis of high-grade cervical intraepithelial neoplasia.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-CD8 (SP57) Rabbit Monoclonal Primary Antibody
    CONFIRM anti-CD8 (SP57) Rabbit Monoclonal Primary Antibody CONFIRM anti-CD8 (SP57) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of CD8 by light microscopy in sections of formalin-fixed, paraffin- embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CD31 (JC70) Mouse Monoclonal Antibody
    CD31 (JC70) Mouse Monoclonal Antibody CD31 (JC70) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the CD31 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-Estrogen Receptor (ER) (SP1) Rabbit Monoclonal Primary Antibody
    CONFIRM anti-Estrogen Receptor (ER) (SP1) Rabbit Monoclonal Primary Antibody CONFIRM anti-Estrogen Receptor (ER) (SP1) Rabbit Monoclonal Primary Antibody (CONFIRM anti-ER (SP1) antibody) is intended for laboratory use in the qualitative detection of estrogen receptor (ER) antigen in sections of formalin-fixed, paraffin-embedded breast tissue on a VENTANA automated slide stainer with VENTANA detection kits and ancillary reagents. CONFIRM anti-ER (SP1) antibody is directed against an epitope present on human ER alpha protein located in the nucleus of ER positive normal and neoplastic cells. CONFIRM anti-ER (SP1) antibody is indicated as an aid in the management, prognosis, and prediction of hormone therapy for breast carcinoma.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.Prescription use only.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Hematoxylin II
    Hematoxylin II Hematoxylin II is a modified Mayer's hematoxylin intended for laboratory use in staining cellular nuclei on slides containing cells from frozen tissue, or formalin fixed, paraffin‑embedded tissue on a BenchMark IHC/ISH instrument. This reagent is intended as a counterstain to immunohistochemistry, and in situ hybridization applications.This reagent is intended for in vitro diagnostic use.
    IVD For in vitro diagnostic use.
    A-1-Antichymotrypsin Rabbit Polyclonal Antibody
    A-1-Antichymotrypsin Rabbit Polyclonal Antibody A-1-Antichymotrypsin Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the alpha-1 antichymotrypsin protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Actin, Smooth Muscle (1A4) Mouse Monoclonal Antibody
    Actin, Smooth Muscle (1A4) Mouse Monoclonal Antibody Actin, Smooth Muscle (1A4) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the smooth muscle actin protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Amplification anti-HQ HRP Multimer
    DISCOVERY Amplification anti-HQ HRP Multimer DISCOVERY Amplification anti-HQ HRP Multimer is designed to be used in conjunction with the DISCOVERY Amplification HQ Kit and DISCOVERY Multimer detection kits to allow the detection of lower copy number molecules or low expressing antigens on the DISCOVERY series of instruments.
    IVD For in vitro diagnostic use.
    Actin, Muscle Specific (HHF35) Mouse Monoclonal Antibody
    Actin, Muscle Specific (HHF35) Mouse Monoclonal Antibody Actin, Muscle Specific (HHF35) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the actin, muscle-specific protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Amplification anti-HQ AP Multimer
    DISCOVERY Amplification anti-HQ AP Multimer DISCOVERY Amplification HQ Alkaline Phosphatase Multimerkit is designed to be used in conjunction with the DISCOVERY Amplification HQ Kit and DISCOVERY Multimer detection kits to allow the detection of lower copy number molecules or low expressing antigens on the DISCOVERY series of instruments.
    IVD For in vitro diagnostic use.
    Alpha-Fetoprotein Rabbit Polyclonal Antibody
    Alpha-Fetoprotein Rabbit Polyclonal Antibody Alpha-Fetoprotein Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of Alpha-Fetoprotein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-Arginase-1 (SP156) Rabbit Monoclonal Primary Antibody
    anti-Arginase-1 (SP156) Rabbit Monoclonal Primary Antibody anti-Arginase-1 (SP156) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the Arginase-1 enzyme in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Inhibitor
    DISCOVERY Inhibitor DISCOVERY Inhibitor is a hydrogen peroxide reagent designed for the quenching of endogenous peroxidase during immunohistochemical (IHC) and in situ hybridization (ISH) protocols on the DISCOVERY series of instruments with NexES 9.0 or later software.DISCOVERY Inhibitor can be used prior to the application of HRP conjugates in the ISH/IHC assays or after the deposition of HRP chromogens to quench previously bound HRP so that a multiplex with multiple HRP chromogens can be achieved.
    IVD For in vitro diagnostic use.
    Neurofilament (2F11) Mouse Monoclonal Antibody
    Neurofilament (2F11) Mouse Monoclonal Antibody Neurofilament (2F11) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the neurofilament protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Anti-NP AP
    DISCOVERY Anti-NP AP DISCOVERY anti-NP AP is a mouse monoclonal antibody designed to detect the proprietary hapten Nitropyrazole (NP) conjugated to alkaline phosphatase (AP) which can be used to turn over known AP substrates such as fast red/naphthol or NBT/BCIP. It consists of a robust chemistry that provides a clean background in combination with enhanced specificity and sensitivity, which increases the signal-to-noise ratio.DISCOVERY anti-NP AP is designed to be used in conjunction with the DISCOVERY anti-Rabbit NP or anti-Mouse NP on the DISCOVERY XT and DISCOVERY ULTRA (DISCOVERY series) instruments and VENTANA ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY OmniMap anti-Gt HRP (RUO)
    DISCOVERY OmniMap anti-Gt HRP (RUO) Biotin-free DAB Detection Systems for the Ventana DISCOVERY Series of Instruments OmniMap anti-Gt HRP is a biotin-free conjugate based on proprietary multimer technology. It consists of a robust chemistry that provides clean background in combination with enhanced specificity and sensitivity, which increases the signal-to-noise ratio. It is designed to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ ancillary reagents for optimal performance.
    IVD For in vitro diagnostic use.
    OptiView Amplification Kit
    OptiView Amplification Kit OptiView Amplification Kit may be used in conjunction with the OptiView DAB IHC Detection Kit to increase the staining intensity of mouse and rabbit primary antibodies. The kit is to be used for qualitative staining of formalin-fixed, paraffin-embedded tissue, or frozen tissue on a BenchMark IHC/ISH instrument with VENTANA primary antibodies and ancillary reagents, visualized by light microscopy.The clinical interpretation of any staining, or the absence of staining, must be complemented by morphological studies and evaluation of proper controls. Evaluation must be made by a qualified pathologist within the context of the patient’s clinical history and other diagnostic tests.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Thyroglobulin (2H11+6E1) Mouse Monoclonal Antibody
    Thyroglobulin (2H11+6E1) Mouse Monoclonal Antibody Thyroglobulin (2H11+6E1) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of thyroglobulin in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY UltraMap anti-Gt HRP
    DISCOVERY UltraMap anti-Gt HRP Biotin-free DAB Detection Systems for the Ventana DISCOVERY Series of Instruments UltraMap anti-Gt is a biotin-free detection systems based on proprietary multimer technology. It consists of a robust chemistry that provides clean background in combination with enhanced specificity and sensitivity, which increases the signal-to-noise ratio. It is designed to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY UltraMap anti-Rt HRP
    DISCOVERY UltraMap anti-Rt HRP Biotin-free DAB Detection Systems for the Ventana DISCOVERY Series of Instruments UltraMap anti-Rt is a biotin-free detection systems based on proprietary multimer technology. It consists of a robust chemistry that provides clean background in combination with enhanced specificity and sensitivity, which increases the signal-to-noise ratio. It is designed to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ ancillary reagents for optimal performance.
    IVD For in vitro diagnostic use.
    Ep-CAM/Epithelial Specific Antigen (Ber-EP4) Mouse Monoclonal Antibody
    Ep-CAM/Epithelial Specific Antigen (Ber-EP4) Mouse Monoclonal Antibody Ep-CAM/Epithelial Specific Antigen (Ber-EP4) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the Ep-CAM glycoprotein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Renal Cell Carcinoma (PN-15) Mouse Monoclonal Antibody
    Renal Cell Carcinoma (PN-15) Mouse Monoclonal Antibody Anti-Renal Cell Carcinoma (PN-15) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the GP200 glycoprotein in formalin-fixed, paraffin-embedded neoplastic tissue stained on VENTANA BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Anti-Rabbit NP
    DISCOVERY Anti-Rabbit NP DISCOVERY anti-Rabbit NP is a goat anti rabbit polyclonal antibody hapten-labeled with NP (Nitropyrazole) to be detected by DISCOVERY anti-NP AP (760-4827, 07425325001). It consists of a robust chemistry that provides clean background in combination with enhanced specificity and sensitivity, which increases the signal-to-noise ratio.DISCOVERY antiRabbit NP is designed to be used in conjunction with the DISCOVERY XT and DISCOVERY ULTRA (DISCOVERY series) instruments and VENTANA ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Red Kit (RUO)
    DISCOVERY Red Kit (RUO) The DISCOVERY Red Kit was designed for antigen localization in frozen sections or formalin-fixed, paraffin-embedded tissue sections, to be used in conjunction with the Discovery series of instruments and Ventana Medical Systems’ ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Anti-Mouse NP
    DISCOVERY Anti-Mouse NP DISCOVERY anti-Mouse NP is a goat anti mouse polyclonal antibody hapten-labeled with NP (Nitropyrazole) to be detected by DISCOVERY anti-NP AP (760-4827, 07425325001). It consists of a robust chemistry that provides clean background in combination with enhanced specificity and sensitivity, which increases the signal-to-noise ratio.DISCOVERY antiMouse NP is designed to be used in conjunction with the DISCOVERY XT and DISCOVERY ULTRA (DISCOVERY series) instruments and VENTANA ancillary reagents for optimal performance.
    IVD For in vitro diagnostic use.
    Myeloperoxidase Rabbit Polyclonal Antibody
    Myeloperoxidase Rabbit Polyclonal Antibody Anti-Myeloperoxidase Polyclonal Primary Antibody is intended for laboratory use in the detection of the myeloperoxidase protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Myoglobin Rabbit Polyclonal Antibody
    Myoglobin Rabbit Polyclonal Antibody Myoglobin Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the Myoglobin protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY S Block (RUO)
    DISCOVERY S Block (RUO) Serum-based Blocking Solution for Reduction of Non-specific Binding of Antibodies for Use with DISCOVERY Detection Kits on the Ventana DISCOVERY Series of Instruments S Block is a normal serum cocktail (goat, sheep, and donkey) reagent designed for the blocking of non-specific binding of antibodies during immunohistochemical (IHC) and in situ hybridization (ISH) protocols on the DISCOVERY series of instruments with NexES 9.0 or later software.S Block can be used at primary and/or secondary antibody steps in the ISH/IHC BlueMap Kit, DAB Map Kit, RedMap Kit, or DoubleStain procedures. S Block should be used when background staining due to the non-specific binding of primary and/or secondary antibodies is an issue.
    IVD For in vitro diagnostic use.
    CD2 (MRQ-11) Mouse Monoclonal Antibody
    CD2 (MRQ-11) Mouse Monoclonal Antibody CD2 (MRQ-11) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the CD2 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CD21 (2G9) Mouse Monoclonal Antibody
    CD21 (2G9) Mouse Monoclonal Antibody CD21 (2G9) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the CD21 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CD71 (MRQ-48) Mouse Monoclonal Antibody
    CD71 (MRQ-48) Mouse Monoclonal Antibody CD71 (MRQ-48) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of CD71 in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-c-MYC (Y69) Rabbit Monoclonal Primary Antibody
    anti-c-MYC (Y69) Rabbit Monoclonal Primary Antibody Anti-c-MYC (Y69) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of c- MYC protein by light microscopy in sections of formalin-fixed, paraffin- embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.  
    IVD For in vitro diagnostic use.
    COX-2 (SP21) Rabbit Monoclonal Antibody
    COX-2 (SP21) Rabbit Monoclonal Antibody COX-2 (SP21) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the COX-2 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> Kappa and Lambda Dual ISH mRNA Probe Cocktail
    VENTANA® Kappa and Lambda Dual ISH mRNA Probe Cocktail CE-IVD VENTANA Kappa and Lambda Dual ISH mRNA Probe Cocktail is intended for the qualitative detection of Kappa mRNA and Lambda mRNA in formalin-fixed, paraffin-embedded (FFPE) human bone marrow and lymphoid tissue stained on a BenchMark IHC/ISH instrument using chromogenic in situ hybridization (ISH) and visualized using light microscopy. VENTANA Kappa and Lambda Dual ISH mRNA Probe Cocktail is intended as an aid in the identification of B-cell lymphomas and plasma cell neoplasms.Results of the assay should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    PATHWAY<sup>®</sup> Anti-c-KIT (9.7) Primary Antibody
    PATHWAY® Anti-c-KIT (9.7) Primary Antibody This antibody is intended for in vitro diagnostic (IVD) use.Ventana® Medical Systems’ PATHWAY Anti-c-KIT (9.7) Primary Antibody is intended for laboratory use, via light microscopy, for the qualitative detection of KIT protein in formalin-fixed, paraffin-embedded gastrointestinal stromal tumors (GISTs) using either an automated immunohistochemistry staining system or a manual assay. It is indicated as an aid in the diagnosis of GIST within the context of the patient’s clinical history, tumor morphology, and other diagnostic tests evaluated by a qualified pathologist. It may be used after the diagnosis of GIST as an aid in the selection of GIST patients who may qualify for imatinib mesylate (Gleevec®/Glivec®) therapy.PATHWAY Anti-c-KIT (9.7) Primary Antibody is optimized for use on Ventana Automated Slide Stainer and for manual application in combination with Ventana Medical Systems’ iVIEW™ DAB Detection Kit and accessories. The clinical interpretation of any staining, or the absence of staining, must be complemented by morphological studies and evaluation of proper controls. Evaluation must be made by a qualified pathologist within the context of the patient’s clinical history and other diagnostic tests.Note:The test is not intended as the sole basis for making the diagnosis of GIST and is not intended as the sole basis for selecting Gleevec/Glivec therapy. The proportion of c-KIT negative GIST patients who can respond to Gleevec/Glivec has not been established. A negative result would not necessarily exclude the diagnosis of GIST, nor should it preclude treatment with Gleevec/Glivec (14, 34, 39).All of the subjects in the Novartis Gleevec/Glivec clinical trials were selected using an investigational immunocytochemical antibody (ICA). None of the subjects in those trials were selected using the Ventana PATHWAY Anti-c-KIT (9.7) Primary Antibody. The Ventana PATHWAY Anti-c-KIT (9.7) Primary Antibody was compared to the ICA on independent sets of samples and found to provide acceptably concordant results.13. Heinrich, M., Wait, C. L., Yee, K. W. H., and Griffith, D. J. STI571 inhbits the kinase activity of wild type and juxtamembrane c-KIT mutants but not the exon 17 D816V mutation associated with mastocytosis., Blood. 96: 173b (Abstr.), 200134. Taniguchi, M., Nishida, T., Hirota, S., Isozaki, K., Ito, T., Nomura, T., Matsuda, H., and Kitamura, Y. Effect of c-KIT mutation on prognosis of gastrointestinal stromal tumors, Cancer Res. 59: 4297-300, 1999.39. Medeiros, F., Corless, C.L., Duensing, A., Hornick, J.L., Oliveira, A.M., Heinrich, M.C., Fletcher, J.A., Fletcher, C.D. KIT-negative gastrointestinal stromal tumors: Proof of concept and therapeutic implications. Am J Surg Pathol. Jul 28(7): 889-894 2004
    IVD For in vitro diagnostic use.
    Cytokeratin (OSCAR) Mouse Monoclonal Antibody
    Cytokeratin (OSCAR) Mouse Monoclonal Antibody Cytokeratin (OSCAR) Mouse Monoclonal Antibody is intended for laboratory use in the detection of a broad spectrum of Cytokeratin proteins in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Universal Secondary Antibody (RUO)
    DISCOVERY Universal Secondary Antibody (RUO) Universal Secondary Antibody is designed to work with the DISCOVERY line of detection kits when mouse or rabbit primary antibodies are employed. The Universal Secondary Antibody can be used for antigen localization in frozen sections, formalin- or paraformaldehyde-fixed, paraffin-embedded sections.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY mRNA Probe Amplification Kit
    DISCOVERY mRNA Probe Amplification Kit DISCOVERY mRNA Probe Amplification Kit is a user fillable kit to be filled with the appropriate ACD reagents. This kit is to be utilized alongside the corresponding mRNA amplification and mRNA detection kits on DISCOVERY staining platforms.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY QD DAPI (RUO)
    DISCOVERY QD DAPI (RUO) DAPI (4',6-Diamidino-2-phenylindole) Counterstain Kit for the Ventana Discovery Series of Instruments The DAPI Counterstain Kit was designed for nuclear staining of cytological preparations, frozen sections, or formalin-fixed, paraffin-embedded tissue sections.QD DAPI Counterstain Kit was designed to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ Quantum Dot line of products.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> anti-ALK (D5F3) Rabbit Monoclonal Primary Antibody
    VENTANA® anti-ALK (D5F3) Rabbit Monoclonal Primary Antibody CE-IVD VENTANA anti-ALK (D5F3) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative detection of the anaplastic lymphoma kinase (ALK) protein in formalin-fixed, paraffin-embedded non-small cell lung carcinoma (NSCLC) tissue stained on a BenchMark IHC/ISH instrument. It is indicated as an aid in identifying patients eligible for treatment with XALKORI® (crizotinib), ZYKADIA® (ceritinib), ALECENSA® (alectinib), or lorlatinib.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-ALK1 (ALK01) Primary Antibody
    CONFIRM anti-ALK1 (ALK01) Primary Antibody US-FDA CONFIRM anti-ALK1 (ALK01) Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of anaplastic lymphoma kinase (ALK) protein by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CD14 (EPR3653) Rabbit Monoclonal Antibody
    CD14 (EPR3653) Rabbit Monoclonal Antibody CD14 (EPR3653) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the CD14 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    ASR Analyte Specific Reagent. Analytical and performance characteristics are not established.
    HPV 11 mRNA Probe
    HPV 11 mRNA Probe Ventana Medical Systems (Ventana) HPV 11 mRNA Probe is intended for use as a raw material in Laboratory Developed Tests (LDTs). The HPV 11 mRNA probe is a DNP hapten labeled probe designed to bind to the HPV 11 E6/E7 mRNA transcript. The probe has affinity to the HPV 11 genotype. HPV 6 and HPV 11 sequences are highly homologous, therefore the HPV 11 mRNA Probe may cross react with HPV 6 E6/E7 mRNA, if present, in the tissue specimen.Depending on the conditions used within a laboratory developed test, cross reactivity to the complementary HPV 11 DNA sequence may occur.In the U.S., Analyte Specific Reagent. Analytical and performance characteristics are not established.
    ASR Analyte Specific Reagent. Analytical and performance characteristics are not established.
    HPV 6 mRNA Probe
    HPV 6 mRNA Probe Ventana Medical Systems (Ventana) HPV 6 mRNA Probe is intended for use as a raw material in Laboratory Developed Tests (LDTs). The HPV 6 mRNA probe is a DNP hapten labeled probe designed to bind to the HPV 6 E6/E7 mRNA transcript. The probe has affinity to the HPV 6 genotype. HPV 6 and HPV 11 sequences are highly homologous, therefore the HPV 6 mRNA Probe may cross react with HPV 11 E6/E7 mRNA, if present, in the tissue specimen.Depending on the conditions used within a laboratory developed test, cross reactivity to the complementary HPV 6 DNA sequence may occur.In the U.S., Analyte Specific Reagent. Analytical and performance characteristics are not established.
    ASR Analyte Specific Reagent. Analytical and performance characteristics are not established.
    HPV 16 mRNA Probe
    HPV 16 mRNA Probe Ventana Medical Systems (Ventana) HPV 16 mRNA Probe is intended for use as a raw material in Laboratory Developed Tests (LDTs). The HPV 16 mRNA probe is a DNP hapten labeled probe designed to bind to the HPV 16 E6/E7 mRNA transcript. The probe has affinity to the HPV 16 genotype with no known cross reactivity to other common HPV genotypes.Depending on the conditions used within a laboratory developed test, cross reactivity to the complementary HPV 16 DNA sequence may occur.In the U.S., Analyte Specific Reagent. Analytical and performance characteristics are not established.
    ASR Analyte Specific Reagent. Analytical and performance characteristics are not established.
    HPV 33 mRNA Probe
    HPV 33 mRNA Probe Ventana Medical Systems (Ventana) HPV 33 mRNA Probe is intended for use as a raw material in Laboratory Developed Tests (LDTs). The HPV 33 mRNA probe is a DNP hapten labeled probe designed to bind to the HPV 33 E6/E7 mRNA transcript. The probe has affinity to the HPV 33 genotype with no known cross reactivity to other common HPV genotypes.Depending on the conditions used within a laboratory developed test, cross reactivity to the complementary HPV 33 DNA sequence may occur.In the U.S., Analyte Specific Reagent. Analytical and performance characteristics are not established. 
    GLU For general laboratory use.
    ISH Amplification Kit
    ISH Amplification Kit The ISH Amplification Kit may be used in conjunction with DNP detection to improve the signal intensity of DNP-labeled probes. The kit is to be used for qualitative staining by in situ hybridization (ISH) in sections of formalin-fixed, paraffin-embedded tissue on VENTANA IHC/ISH instruments with VENTANA ISH probes and ancillary reagents.The result is visualized by light microscopy.
    IVD For in vitro diagnostic use.
    CINtec<sup>®</sup> p16 Histology
    CINtec® p16 Histology CE-IVD CINtec p16 Histology is an immunohistochemistry assay for the qualitative detection of the p16INK4a protein on formalin-fixed, paraffin-embedded tissue sections prepared from cervical biopsies. It is indicated to be used in conjunction with H&E stained slides prepared from the same cervical tissue specimen as an aid to increase diagnostic accuracy and inter-observer agreement in the diagnosis of highgrade cervical intraepithelial neoplasia.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    ASR Analyte Specific Reagent. Analytical and performance characteristics are not established.
    U6 DNP Probe
    U6 DNP Probe The U6 DNP Probe is intended for use as a raw material in laboratory developed tests (LDTs). The U6 DNP Probe is a DNP hapten labeled probe designed to bind to U6 small nuclear RNA.In the U.S., Analyte Specific Reagent. Analytical and performance characteristics are not established.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> anti-p120 catenin (98) Mouse Monoclonal Primary Antibody
    VENTANA® anti-p120 catenin (98) Mouse Monoclonal Primary Antibody VENTANA anti-p120 catenin (98) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of p120 by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrumentThis product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM Negative Control Rabbit Ig
    CONFIRM Negative Control Rabbit Ig CONFIRM Negative Control Rabbit Ig is intended for laboratory use as a control for non-specific binding of rabbit immunoglobulin in sections of formalin fixed, paraffin embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-Glypican 3 (GC33) Mouse Monoclonal Primary Antibody
    anti-Glypican 3 (GC33) Mouse Monoclonal Primary Antibody Anti-Glypican 3 (GC33) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of glypican 3 by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    <i>ultra</i>View Red ISH DIG Detection Kit
    ultraView Red ISH DIG Detection Kit Ventana Medical Systems’ (Ventana) ultraView Red ISH DIG Detection Kit is an indirect, biotin-free system for detecting DIG labeled probes. The kit is intended to identify targets by chromogenic red in situ hybridization (ISH) in sections of formalin fixed, paraffin embedded tissue that are stained on Ventana BenchMark Series instruments.The clinical interpretation of any staining, or the absence of staining, must be complemented by histological examination and evaluation of proper controls. Evaluation must be made by a qualified reader within the context of the patient’s clinical history and other diagnostic tests.This detection kit is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-Epithelial Related Antigen (MOC-31) Mouse Monoclonal Primary Antibody
    anti-Epithelial Related Antigen (MOC-31) Mouse Monoclonal Primary Antibody Anti-Epithelial Related Antigen (MOC-31) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of epithelial cell adhesion molecule (EpCAM) by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.  
    IVD For in vitro diagnostic use.
    CONFIRM anti-Epidermal Growth Factor Receptor (3C6) Primary Antibody
    CONFIRM anti-Epidermal Growth Factor Receptor (3C6) Primary Antibody This antibody is intended for in vitro diagnostic (IVD) use.Ventana Medical Systems’ (Ventana) CONFIRM anti-Epidermal Growth Factor Receptor (EGFR) (3C6) Primary Antibody is a mouse monoclonal antibody (IgG1) directed against the extracellular domain of human EGFR protein of 170kD. The antibody also recognizes the type III variant of 145kD. This antibody is intended for laboratory use, via light microscopy, for the qualitative detection of EGFR in formalin fixed, paraffin embedded tissue on a Ventana automated slide stainer.The clinical interpretation of any staining, or the absence of staining, must be complemented by morphological studies and evaluation of proper controls. Evaluation must be made by a qualified pathologist within the context of the patient’s clinical history and other diagnostic tests. Prescription only.
    IVD For in vitro diagnostic use.
    anti-ERG (EPR3864) Rabbit Monoclonal Primary Antibody
    anti-ERG (EPR3864) Rabbit Monoclonal Primary Antibody Anti-ERG (EPR3864) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of both wildtype ERG, and truncated ERG resulting from ERG gene rearrangement, by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-Cytokeratin 17 (SP95) Rabbit Monoclonal Primary Antibody
    anti-Cytokeratin 17 (SP95) Rabbit Monoclonal Primary Antibody Anti-Cytokeratin 17 (SP95) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of cytokeratin 17 (CK17) by light microscopy in sections of formalin- fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-p53 (Bp53-11) Primary Antibody
    anti-p53 (Bp53-11) Primary Antibody Anti-p53 (Bp53-11) Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of p53 protein by light microscopy in sections of formalin- fixed, paraffin-embedded tissue on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-Cytokeratin (CAM 5.2) Mouse Monoclonal Primary Antibody
    anti-Cytokeratin (CAM 5.2) Mouse Monoclonal Primary Antibody Anti-Cytokeratin (CAM 5.2) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of cytokeratin 7 (CK7) and cytokeratin 8 (CK8) by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY BlueMap Kit (RUO)
    DISCOVERY BlueMap Kit (RUO) The DISCOVERY BlueMap Kit was designed for mRNA and antigen localization in frozen sections, formalin/paraformaldehyde-fixed, paraffin-embedded (FFPE) tissue sections, or IHC applications requiring added sensitivity. The BlueMap Kit was designed to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ ancillary reagents for optimal performance.
    GLU For general laboratory use.
    <b>navify<sup>®</sup></b> Pathology Lab Hub
    navify® Pathology Lab Hub navify® Pathology Lab Hub delivers a solution which provides universal LIS connectivity for Roche's product portfolio and competitors’ products used in Anatomic Pathology laboratories. navify® Pathology Lab Hub may be used in histology and/or cytology and/or molecular labs. navify® Pathology Lab Hub addresses the connectivity needs of Roche's customers by providing a single interface point for all data routing between LIS systems and their product portfolio, and by routing data without manipulation or changes to the message content.The intended use of navify® Pathology Lab Hub is the following:Connect laboratories' LIS system(s) and product portfolio through a single middlewareReceive order information from the customer’s LIS system and route this to appropriate productsRoute data/information (status updates, reports, analysis data, etc.) back to the customers’ LIS system(s)Route data within Roche customers’ product portfolioThe different types of information are listed below.TypeDescriptionPatientData about a patient such as name, surname, date of birth, gender, contact, relationship with their cases...CaseData about thecase such as number, date of registration, demographic, relationship with their specimens, host identifier that has called the case...ContainerThe sample is allocated in the container. Some of the fields are the identification of the specimen, the location of the sample, the sample type (organ, tissue, mass, biopsy, liquid,...), relationship with their blocks,...SpecimenTissue sample held in a container.BlockThe block contains a piece of tissue to be evaluated. Some of the fields are the identification of the block or cassette, their status (marked, verified, embedded), relationship with their slides,...SlideIt contains one of the cuts which has been made from the sample. Some of the fields are the identification of the slide, the orientation of the cut, the stain protocol performed, its status (printed, staining, stained, assembled), location of pictures that have been done on the slide.Types of information processed through navify® Pathology Lab Hub.
    IVD For in vitro diagnostic use.
    Protease 3
    Protease 3 Protease 3 is an endopeptidase (alkaline protease) of the serine protease family and cleaves proteins in the tissue section, allowing primary antibodies to recognize and bind epitope(s). The reagent is intended for enzymatic digestion of sections of formalin-fixed, paraffin-embedded tissue on BenchMark IHC/ISH instrument.This reagent is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Protease 2
    Protease 2 Protease 2 is an endopeptidase (alkaline protease) of the serine protease family and cleaves proteins in the tissue section, allowing primary antibodies to recognize and bind epitope(s). The reagent is intended for enzymatic digestion of sections of routine formalin-fixed, paraffin-embedded tissue on a BenchMark IHC/ISH instrument.This reagent is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Hematoxylin
    Hematoxylin Hematoxylin is a modified Gill's hematoxylin intended for laboratory use in staining cellular nuclei on slides containing cells from frozen tissue, formalin-fixed, paraffin-embedded tissue, or cytologic preparations on a BenchMark IHC/ISH instrument. This reagent is intended as a counterstain to immunohistochemistry and immunocytochemistry applications.This reagent is intended for in vitro diagnostic use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-S100 (Polyclonal) Primary Antibody
    CONFIRM anti-S100 (Polyclonal) Primary Antibody CONFIRM anti-S100 (Polyclonal) Primary Antibody is a rabbit  polyclonal antibody intended for laboratory use in the qualitative immunohistochemical detection of S100 protein by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use. 
    IVD For in vitro diagnostic use.
    Roche Pathway HER2 4B5 assay slide and therapy image
    PATHWAY anti-HER-2/neu (4B5) Rabbit Monoclonal Primary Antibody PATHWAY HER2/neu (4B5) Rabbit Monoclonal Primary Antibody, one of over 250 optimized pre-diluted reagents for use on the BenchMark IHC/ISH automated slide staining instruments by Roche Diagnostics.
    IVD For in vitro diagnostic use.
    HER2 DUAL ISH thumbnail image
    VENTANA® HER2 Dual ISH DNA Probe Cocktail US-FDA The VENTANA HER2 Dual ISH DNA Probe Cocktail assay is a fully automated, ready-to-use brightfield solution for determining HER2 gene status.
    IVD For in vitro diagnostic use.
    PD-L1 SP263 Assay UC stain image
    VENTANA® PD-L1 (SP263) Assay US-FDA VENTANA PD-L1 (SP263) Assay is a qualitative immunohistochemical assay using rabbit monoclonal anti-PD-L1 clone SP263 intended for use in the assessment of the PD-L1 protein in formalin-fixed, paraffin-embedded (FFPE) urothelial carcinoma tissue stained with OptiView DAB IHC Detection Kit on a VENTANA BenchMark ULTRA instrument.
    IVD For in vitro diagnostic use.
    Protease 1
    Protease 1 Protease 1 is an endopeptidase (alkaline protease) of the serine protease family and cleaves proteins in the tissue section, allowing primary antibodies to recognize and bind epitope(s). The reagent is intended for enzymatic digestion of sections of routine formalin-fixed, paraffin-embedded tissue on a Benchmark IHC/ISH instrument.This reagent is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    ISH Protease 2
    ISH Protease 2 ISH Protease 2 is intended for enzymatic digestion of formalin-fixed, paraffin-embedded tissue sections, or whole cell preparations on a BenchMark IHC/ISH instrument. This reagent removes protein that surrounds the target nucleic acid sequences of interest during in situ hybridization applications.This reagent is intended for in vitro diagnostic (IVD) use.Enzymatic digestion using VENTANA ISH Protease 2 removes cross-linking of proteins to ensure that the probe of interest reaches its target DNA or RNA sequence.1 Digestion is followed by probe application and is used in combination with VENTANA detection kits.1. Beesley JE. Immunocytochemistry and In Situ Hybridization in the Biomedical Sciences. Boston: Birkhäuser, 2001.
    IVD For in vitro diagnostic use.
    ISH <i>i</i>VIEW<sub>Blue</sub> Plus Detection Kit
    ISH iVIEWBlue Plus Detection Kit Ventana Medical Systems, Inc.’s (Ventana) ISH iVIEW Blue Plus Detection Kit consists of a primary rabbit anti-DNP antibody followed by an indirect biotin streptavidin system for detecting VENTANA DNP labeled probes and antibodies. This kit is intended for staining sections of routinely fixed (neutral buffered formalin), paraffin embedded tissue on the BenchMark series automated slide stainers.Light microscopy is used to detect the staining intensity. Positive results aid in the classification of normal and abnormal cells and tissues and serve as an adjunct to conventional histopathology tests.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> FGFR2b (FPR2-D) Mouse Monoclonal Antibody
    VENTANA® FGFR2b (FPR2-D) Mouse Monoclonal Antibody VENTANA FGFR2b (FPR2-D) Mouse Monoclonal Antibody is intended for laboratory use in the qualitative immunohistochemical detection of FGFR2b by light microscopy in sections of formalin-fixed, paraffin-embedded tissues stained on a BenchMark IHC/ISH instrument. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    Hematopathology assay
    Hematopathology cancer IHC/ISH panel
    Dermatopathology IHC assay panel icon
    Dermatopathology IHC panel
    Roche breast cancer IHC Assay panel icon
    Breast cancer IHC/ISH portfolio
    VENTANA MMR RxDx panel icon
    VENTANA® MMR RxDx Panel
    VENTANA MMR RxDx panel icon
    VENTANA® MMR RxDx Panel
    error errorMessage
    Sorry, we couldn't find the content you are looking for
    Please try again later