You appear to be using incognito/private browsing mode or an ad blocker, which may adversely affect your experience on the site. Please disable any ad blockers and view the site in non-private mode.
Analyte Specific Reagent. Analytical and performance characteristics are not established. Others Lambda DNP Probe 704-733 ASR Lambda DNP Probe (704-733) RTD001019 06 543 448 001 6 543 448 001 06543448001 6543448001 06543448001 Lambda DNP Probe (704-733), ASR Lambda DNP Probe (704-733) 04015630970728 Reagents, kits 760-1206 1.5 mL Not Available true Analyte Specific Reagent. Analytical and performance characteristics are not established.Ventana Medical Systems (Ventana) Lambda DNP Probe (704-733) is designed to bind to Lambda light chain mRNA. The probe sequence is complementary to the Lambda mRNA sequence: 5’CCGUGGAGAAGACAGUGGCCCCUACAGAAU3’. en