You appear to be using incognito/private browsing mode or an ad blocker, which may adversely affect your experience on the site. Please disable any ad blockers and view the site in non-private mode.
Analyte Specific Reagent. Analytical and performance characteristics are not established. Others Kappa DNP Probe 495-524 ASR Kappa DNP Probe (495-524) RTD001012 06543391001 Kappa DNP Probe (495-524), ASR Kappa DNP Probe (495-524) 04015630970674 Reagents, kits 760-1201 1.5 mL Not Available true Ventana Medical Systems (Ventana) Kappa DNP Probe (495-524) is designed to bind to kappa light chain mRNA. The probe sequence is complementary to the Kappa mRNA sequence: 5’UGCCUCUGUUGUGUGCCUGCUGAAUAACUU3’. en
Kappa DNP Probe (495-524)
ASRAnalyte Specific Reagent. Analytical and performance characteristics are not established.