You appear to be using incognito/private browsing mode or an ad blocker, which may adversely affect your experience on the site. Please disable any ad blockers and view the site in non-private mode.
Analyte Specific Reagent. Analytical and performance characteristics are not established. Others Kappa DNP Probe 597-626 ASR Kappa DNP Probe (597-626) RTD001014 06543413001 Kappa DNP Probe (597-626), ASR Kappa DNP Probe (597-626) 04015630970698 Reagents, kits 760-1203 1.5 mL Not Available true Ventana Medical Systems (Ventana) Kappa DNP Probe (597-626) is designed to bind to kappa light chain mRNA. The probe sequence is complementary to the Kappa mRNA sequence: 5’CACAGAGCAGGACAGCAAGGACAGCACCUA3’ en
Kappa DNP Probe (597-626)
ASRAnalyte Specific Reagent. Analytical and performance characteristics are not established.