Analyte Specific Reagent. Analytical and performance characteristics are not established. Others Kappa DNP Probe 597-626 ASR Kappa DNP Probe (597-626) RTD001014 06 543 413 001 6 543 413 001 06543413001 6543413001 06543413001 Kappa DNP Probe (597-626), ASR Kappa DNP Probe (597-626) 04015630970698 Reagents, kits 760-1203 1.5 mL Not Available true Ventana Medical Systems (Ventana) Kappa DNP Probe (597-626) is designed to bind to kappa light chain mRNA. The probe sequence is complementary to the Kappa mRNA sequence: 5’CACAGAGCAGGACAGCAAGGACAGCACCUA3’ en

User Profile

Select your user profile

Kappa DNP Probe (597-626)

Overview

Detailed Specifications

Ordering Information

Compatible Instruments

Technical Documents

Access important product documentation including relevant certificates and other resources.