You appear to be using incognito/private browsing mode or an ad blocker, which may adversely affect your experience on the site. Please disable any ad blockers and view the site in non-private mode.
Analyte Specific Reagent. Analytical and performance characteristics are not established. Others Kappa DNP Probe 637-666 ASR Kappa DNP Probe (637-666) RTD001015 06543421001 Kappa DNP Probe (637-666), ASR Kappa DNP Probe (637-666) 04015630970704 Reagents, kits 760-1204 1.5 mL Not Available true Ventana Medical Systems (Ventana) Kappa DNP Probe (637-666) is designed to bind to kappa light chain mRNA. The probe sequence is complementary to the Kappa mRNA sequence: 5’AGCACCCUGACGCUGAGCAAAGCAGACUAC3’. en
Kappa DNP Probe (637-666)
ASRAnalyte Specific Reagent. Analytical and performance characteristics are not established.