You appear to be using incognito/private browsing mode or an ad blocker, which may adversely affect your experience on the site. Please disable any ad blockers and view the site in non-private mode.
Analyte Specific Reagent. Analytical and performance characteristics are not established. Others Lambda DNP Probe 664-693 ASR Lambda DNP Probe (664-693) RTD001018 06 543 430 001 6 543 430 001 06543430001 6543430001 06543430001 Lambda DNP Probe (664-693), ASR Lambda DNP Probe (664-693) 04015630970711 Reagents, kits 760-1205 1.5 mL Not Available true Ventana Medical Systems (Ventana) Lambda DNP Probe (664-693) is designed to bind to Lambda light chain mRNA. The probe sequenced is complementary to the Lambda mRNA sequence: 5’CACAGAAGCUACAGCUGCCAGGUCACGCAU3’. en