You appear to be using incognito/private browsing mode or an ad blocker, which may adversely affect your experience on the site. Please disable any ad blockers and view the site in non-private mode.
Analyte Specific Reagent. Analytical and performance characteristics are not established. Others Lambda DNP Probe 768-797 ASR Lambda DNP Probe (768-797) RTD001020 06 543 456 001 6 543 456 001 06543456001 6543456001 06543456001 Lambda DNP Probe (768-797), ASR Lambda DNP Probe (768-797) 04015630970735 Reagents, kits 760-1207 1.5 mL Not Available true Ventana Medical Systems (Ventana) Lambda DNP Probe (768-797) is designed to bind to Lambda light chain mRNA. The probe sequence is complementary to the Lambda mRNA sequence: 5’GAGACUAGAGCUGCAGGAUCCCAGGGGAGG3’. en