You appear to be using incognito/private browsing mode or an ad blocker, which may adversely affect your experience on the site. Please disable any ad blockers and view the site in non-private mode.
Analyte Specific Reagent. Analytical and performance characteristics are not established. Others Lambda DNP Probe 826-855 ASR Lambda DNP Probe (826-855) RTD001021 06 543 464 001 6 543 464 001 06543464001 6543464001 06543464001 Lambda DNP Probe (826-855), ASR Lambda DNP Probe (826-855) 04015630970742 Reagents, kits 760-1208 1.5 mL Not Available true Ventana Medical Systems (Ventana) Lambda DNP Probe (826-855) is designed to bind to Lambda light chain mRNA. The probe is complementary to the Lambda mRNA sequence: 5’GCCCUUCUCCCUGCACUCAAUAAACCCUCA3’. en