Search Search
User Profile
Change
Select your user profile

CONFIRM anti-CD99 (O13) Mouse Monoclonal Primary Antibody

IVD For in vitro diagnostic use.
CONFIRM anti-CD99 (O13) Mouse Monoclonal Primary Antibody
Contact us

Overview

Detailed Specifications

Ordering Information

Compatible Instruments

...
    ...

    Technical Documents

    Access important product documentation including relevant certificates and other resources.

    After clicking below, you will be redirected to eLabDoc, where you can select your local country-specific documents.
    Document repository artboard
    IVD For in vitro diagnostic use.
    VENTANA HER2 Dual ISH DNA Probe Cocktail Assay CDx icon
    VENTANA® HER2 Dual ISH DNA Probe Cocktail CE-IVD The VENTANA HER2 Dual ISH DNA Probe Cocktail assay is a fully automated, ready-to-use brightfield solution for determining HER2 gene status.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> Red ISH DIG Detection Kit
    VENTANA® Red ISH DIG Detection Kit The VENTANA Red ISH DIG Detection Kit is an indirect system for detecting DIG-labeled targets. The kit is intended to identify targets by chromogenic red in situ hybridization (ISH) in sections of formalin-fixed, paraffin-embedded tissue that are stained on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified reader in conjunction with histological examination, relevant clinical information, and proper controls.
    IVD For in vitro diagnostic use.
    VENTANA ALK (D5F3) CDx Assay
    VENTANA® ALK (D5F3) CDx Assay US-FDA The VENTANA ALK (D5F3) CDx Assay empowers your lab to provide timely results with a four-and-one-half hour run time using fully automated, ready-to-use reagents.
    IVD For in vitro diagnostic use.
    CONFIRM anti-Thyroid Transcription Factor-1 (8G7G3/1) Mouse Monoclonal Primary Antibody
    CONFIRM anti-Thyroid Transcription Factor-1 (8G7G3/1) Mouse Monoclonal Primary Antibody Factor-1 (8G7G3/1) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of thyroid transcription factor-1 (TTF-1) by light microscopy in sections of formalin-fixed paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and with proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-MUC1 (H23) Mouse Monoclonal Primary Antibody
    anti-MUC1 (H23) Mouse Monoclonal Primary Antibody Anti-MUC1 (H23) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of MUC1 by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA PD-L1 (SP263) Assay, non-small cell lung cancer (NSCLC), urothelial carcinoma, bladder cancer
    VENTANA® PD-L1 (SP263) Assay CE-IVD VENTANA PD-L1 (SP263) Assay is intended for the qualitative detection of the programmed death ligand 1 (PD-L1) protein in formalin-fixed, paraffin-embedded (FFPE) non-small cell lung cancer (NSCLC), urothelial carcinoma (UC) and other tumor tissues stained with OptiView DAB IHC Detection Kit on a BenchMark IHC/ISH instrument.
    IVD For in vitro diagnostic use.
    PD-L1 SP142 Assay
    VENTANA® PD-L1 (SP142) Assay CE-IVD VENTANA PD-L1 (SP142) Assay is intended for the immunohistochemical assessment of the programmed death-ligand 1 (PD-L1) protein in tumor cells and tumor infiltrating immune cells in formalin-fixed, paraffin-embedded (FFPE) tumor tissue stained with OptiView DAB IHC Detection Kit and OptiView Amplification Kit on a VENTANA BenchMark IHC/ISH instrument.
    IVD For in vitro diagnostic use.
    Smoothelin (R4A) Mouse Monoclonal Antibody
    Smoothelin (R4A) Mouse Monoclonal Antibody Smoothelin (R4A) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the Smoothelin protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-bcl-2 (124) Mouse Monoclonal Primary Antibody
    CONFIRM anti-bcl-2 (124) Mouse Monoclonal Primary Antibody CONFIRM anti-bcl-2 (124) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of B-cell lymphoma 2 protein (bcl-2) by light microscopy in sections of formalin-fixed, paraffin-embedded (FFPE) tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-S100P (16/f5) Mouse Monoclonal Primary Antibody
    anti-S100P (16/f5) Mouse Monoclonal Primary Antibody S100P (16/f5) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the S100P protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Perforin (MRQ-23) Mouse Monoclonal Antibody
    Perforin (MRQ-23) Mouse Monoclonal Antibody Perforin (MRQ-23) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the perforin protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    bcl-6 (GI191E/A8) Mouse Monoclonal Antibody
    bcl-6 (GI191E/A8) Mouse Monoclonal Antibody bcl-6 (GI191E/A8) Mouse Monoclonal Antibody is intended for laboratory use in the detection of the bcl6 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CD33 (SP266) Rabbit Monoclonal Primary Antibody
    CD33 (SP266) Rabbit Monoclonal Primary Antibody CD33 (SP266) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the CD33 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> ISH <i>i</i>VIEW<sub>Blue</sub> Detection Kit
    VENTANA® ISH iVIEWBlue Detection Kit VENTANA ISH iVIEW Blue Detection Kit is an indirect biotin streptavidin system for the detection of fluorescein-labeled probes. The kit is intended to identify targets by in situ hybridization in sections of formalin-fixed, paraffin-embedded tissue that are stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-CD20 (L26) Primary Antibody
    CONFIRM anti-CD20 (L26) Primary Antibody CONFIRM anti-CD20 (L26) Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of CD20 by light microscopy in sections of formalin-fixed, paraffinembedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-CD15 (MMA) Mouse Monoclonal, Primary Antibody
    CONFIRM anti-CD15 (MMA) Mouse Monoclonal, Primary Antibody CONFIRM anti-CD15 (MMA) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of CD15 by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-PAX5 (SP34) Rabbit Monoclonal Primary Antibody
    CONFIRM anti-PAX5 (SP34) Rabbit Monoclonal Primary Antibody CONFIRM anti-PAX5 (SP34) Rabbit Monoclonal Primary Antibody is  intended for laboratory use in the qualitative immunohistochemical detection of PAX5 by light microscopy  in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> anti-p63 (4A4) Mouse Monoclonal Primary Antibody
    VENTANA® anti-p63 (4A4) Mouse Monoclonal Primary Antibody VENTANA anti-p63 (4A4) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of the p63 protein by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> anti-BRAF V600E (VE1) Mouse Monoclonal Primary Antibody
    VENTANA® anti-BRAF V600E (VE1) Mouse Monoclonal Primary Antibody For use with VENTANA MMR IHC Panel, CE-IVD VENTANA anti-BRAF V600E (VE1) Mouse Monoclonal Primary Antibody (VENTANA anti-BRAF V600E (VE1) antibody) is intended for the qualitative detection of BRAF V600E protein in formalin-fixed, paraffin-embedded tissue sections. VENTANA anti-BRAF V600E (VE1) antibody is ready to use on BenchMark IHC/ISH instruments with the OptiView DAB IHC Detection Kit and ancillary reagents.VENTANA anti-BRAF V600E (VE1) antibody is part of the VENTANA MMR IHC Panel which includes VENTANA anti-MLH1 (M1) Mouse Monoclonal Primary Antibody, VENTANA anti-PMS2 (A16-4) Mouse Monoclonal Primary Antibody, VENTANA anti-MSH2 (G219-1129) Mouse Monoclonal Primary Antibody and VENTANA anti-MSH6 (SP93) Rabbit Monoclonal Primary Antibody. The VENTANA MMR IHC Panel is indicated for the detection of mismatch repair protein deficiency as a test for the identification of individuals at risk for Lynch syndrome in patients diagnosed with colorectal cancer (CRC), and, with BRAF V600E status, as an aid to differentiate between sporadic and probable Lynch syndrome CRC in the absence of MLH1 protein expression.These products should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.Intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> Basal Cell Cocktail (34βE12+p63)
    VENTANA® Basal Cell Cocktail (34βE12+p63) VENTANA Basal Cell Cocktail (34βE12+p63) is an antibody cocktail of anti-p63 (4A4) and anti-keratin (34βE12) mouse monoclonal antibodies. VENTANA Basal Cell Cocktail (34βE12+p63) is intended for laboratory use in the qualitative immunohistochemical detection of p63 and cytokeratin 5 in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> Silver ISH DNP Detection Kit
    VENTANA® Silver ISH DNP Detection Kit The VENTANA Silver ISH DNP Detection Kit is an indirect system for detecting DNP- labeled targets. The kit is intended to identify targets by silver in situ hybridization (ISH) in sections of formalin-fixed, paraffin-embedded tissue that are stained on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified reader in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Olig2 (EP112) Rabbit Monoclonal Primary Antibody
    Olig2 (EP112) Rabbit Monoclonal Primary Antibody Olig2 (EP112) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the Olig2 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-LMO2 (SP51) Rabbit Monoclonal Primary Antibody
    anti-LMO2 (SP51) Rabbit Monoclonal Primary Antibody anti-LMO2 (SP51) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the LMO2 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Melanoma Triple Cocktail (HMB45+A103+T311) Primary Antibody
    Melanoma Triple Cocktail (HMB45+A103+T311) Primary Antibody Melanoma Triple Cocktail (HMB45+A103+T311) is a cocktail of anti-Melanosome (HMB45), anti-MART1/melan A (A103), and anti-Tyrosinase (T311) mouse monoclonal antibodies. Melanoma Triple Cocktail (HMB45+A103+T311) is intended for laboratory use in the qualitative  immunohistochemical detection of premelanosome protein (PMEL), melan A, and tyrosinase by light microscopy in sections of formalin-fixed, paraffinembedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use. 
    RUO For Research Use Only. Not for use in diagnostic procedures.
    PSA (ER-PR8) Mouse Monoclonal Antibody
    PSA (ER-PR8) Mouse Monoclonal Antibody RUO Anti-PSA (ER-PR8) may be used as the primary antibody for immunohistochmical staining of formalin-fixed, paraffin-embedded tissue sections.
    IVD For in vitro diagnostic use.
    anti-p504s (SP116) Rabbit Monoclonal Primary Antibody
    anti-p504s (SP116) Rabbit Monoclonal Primary Antibody Anti-p504s (SP116) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of α-methylacyl-CoA racemase (AMACR, also known as p504s) by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-p40 (BC28) Mouse Monoclonal Primary Antibody
    anti-p40 (BC28) Mouse Monoclonal Primary Antibody Anti-p40 (BC28) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of the p40 protein by light microscopy in formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    PSMA (EP192) Rabbit Monoclonal Primary Antibody
    PSMA (EP192) Rabbit Monoclonal Primary Antibody PSMA (EP192) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the PSMA protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    SALL4 (6E3) Mouse Monoclonal Antibody
    SALL4 (6E3) Mouse Monoclonal Antibody SALL4 (6E3) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the SALL4 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-Cytokeratin 14 (SP53) Rabbit Monoclonal Primary Antibody
    anti-Cytokeratin 14 (SP53) Rabbit Monoclonal Primary Antibody Cytokeratin 14 (SP53) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the Cytokeratin 14 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Fascin (55k-2) Mouse Monoclonal Antibody
    Fascin (55k-2) Mouse Monoclonal Antibody Fascin (55k-2) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the fascin protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    TAG-72 (B72.3) Mouse Monoclonal Antibody
    TAG-72 (B72.3) Mouse Monoclonal Antibody TAG-72 (B72.3) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the TAG-72 glycoprotein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Red Counterstain II
    Red Counterstain II Red Counterstain II is intended to aid microscopic bright field observation for in situ hybridization applications. Red Counterstain II is for use with formalin-fixed, paraffin-embedded tissue on a BenchMark IHC/ISH instrument.This reagent is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Myosin, Smooth Muscle (SMMS-1) Mouse Monoclonal Antibody
    Myosin, Smooth Muscle (SMMS-1) Mouse Monoclonal Antibody Myosin, Smooth Muscle (SMMS-1) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of Smooth Muscle Myosin heavy chain in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CD45R (MB1) Mouse Monoclonal Antibody
    CD45R (MB1) Mouse Monoclonal Antibody CD45R (MB1) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the CD45R protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    BG8, Lewis<sup>y</sup> (F3) Mouse Monoclonal Antibody
    BG8, Lewisy (F3) Mouse Monoclonal Antibody BG8, LewisY (F3) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of BG8 in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Mesothelial Cell (HBME-1) Mouse Monoclonal Antibody
    Mesothelial Cell (HBME-1) Mouse Monoclonal Antibody Mesothelial Cell (HBME-1) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the HBME-1 protein in formalin-fixed, paraffin-embedded tissue stained on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Factor XIIIa (EP3372) Rabbit Monoclonal Antibody
    Factor XIIIa (EP3372) Rabbit Monoclonal Antibody Factor XIIIa (EP3372) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of Factor XIIIa in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Oct-4 (MRQ-10) Mouse Monoclonal Antibody
    Oct-4 (MRQ-10) Mouse Monoclonal Antibody Anti-Oct-4 (MRQ-10) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the Oct-4 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Tryptase (G3) Mouse Monoclonal Antibody
    Tryptase (G3) Mouse Monoclonal Antibody Tryptase (G3) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of tryptase in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Reticulum II Staining Kit
    Reticulum II Staining Kit The Reticulum II Staining Kit is intended for laboratory use as a qualitative histologic stain to demonstrate reticular fibers by light microscopy in sections of formalin-fixed, paraffin-embedded (FFPE) tissue stained on a BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Macrophage (HAM-56) Mouse Monoclonal Antibody
    Macrophage (HAM-56) Mouse Monoclonal Antibody Macrophage (HAM-56) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of HAM-56 in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Mucicarmine Staining Kit
    Mucicarmine Staining Kit The Mucicarmine Staining Kit is intended for laboratory use as a qualitative histologic stain to demonstrate acid mucopolysaccharides (mucin) by light microscopy in sections of formalin-fixed, paraffin-embedded (FFPE) tissue stained on a BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    ZAP-70 (2F3.2) Mouse Monoclonal Antibody
    ZAP-70 (2F3.2) Mouse Monoclonal Antibody ZAP-70 (2F3.2) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the ZAP-70 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CD63 (NKI/C3) Mouse Monoclonal Antibody
    CD63 (NKI/C3) Mouse Monoclonal Antibody CD63 (NKI/C3) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the CD63 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-Ki-67 (30-9) Rabbit Monoclonal Primary Antibody
    CONFIRM anti-Ki-67 (30-9) Rabbit Monoclonal Primary Antibody CONFIRM anti-Ki-67 (30-9) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of Ki-67 protein by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-Keratin (34βE12) Mouse Monoclonal Primary Antibody
    CONFIRM anti-Keratin (34βE12) Mouse Monoclonal Primary Antibody CONFIRM anti-Keratin (34βE12) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of cytokeratin 5 by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information and proper controls.This antibody is intended for in vitro diagnostic use.
    IVD For in vitro diagnostic use.
    PGP 9.5 Rabbit Polyclonal Antibody
    PGP 9.5 Rabbit Polyclonal Antibody PGP 9.5 Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the PGP9.5 (UCH-L1) enzyme in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Podoplanin (D2-40) Mouse Monoclonal Antibody
    Podoplanin (D2-40) Mouse Monoclonal Antibody Podoplanin (D2-40) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the Podoplanin glycoprotein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Human Placental Lactogen (hPL) Rabbit Polyclonal Antibody
    Human Placental Lactogen (hPL) Rabbit Polyclonal Antibody Human Placental Lactogen (hPL) Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the hPL protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Nerve Growth Factor Receptor (NGFR) (MRQ-21) Mouse Monoclonal Antibody
    Nerve Growth Factor Receptor (NGFR) (MRQ-21) Mouse Monoclonal Antibody NGFR (Nerve Growth Factor Receptor) (MRQ-21) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of NGFR in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    T-bet (MRQ-46) Rabbit Monoclonal Antibody
    T-bet (MRQ-46) Rabbit Monoclonal Antibody T-bet (MRQ-46) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the T-bet protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Light Green for PAS
    Light Green for PAS Light Green for PAS is intended for laboratory use in staining non-target tissue components and providing contrast with target stains in sections of formalin-fixed, paraffin-embedded (FFPE) tissue on a BenchMark Special Stains instrument.This reagent is intended as a counterstain in special stains applications.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    <i>ultra</i>View Red ISH DIG Detection Kit
    ultraView Red ISH DIG Detection Kit US Ventana Medical Systems, Inc’s (Ventana) ultraView Red ISH DIG Detection Kit is an indirect, biotin-free system for detecting DIG labeled probes. The kit is intended to identify targets by chromogenic red in situ hybridization (ISH) in sections of formalin-fixed, paraffin-embedded tissue that are stained on VENTANA BenchMark XT automated slide stainer or VENTANA BenchMark ULTRA automated slide stainer.The clinical interpretation of any staining, or the absence of staining, must be complemented by histological examination and evaluation of proper controls. Evaluation must be made by a qualified reader within the context of the patient’s clinical history and other diagnostic tests.This detection kit is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-EMA (E29) Mouse Monoclonal Primary Antibody
    CONFIRM anti-EMA (E29) Mouse Monoclonal Primary Antibody CONFIRM anti-EMA (E29) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of epithelial membrane antigen by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.  This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information and proper controls.This antibody is intended for in vitro diagnostic (IVD).
    IVD For in vitro diagnostic use.
    CONFIRM anti-Melanosome (HMB45) Mouse Monoclonal Primary Antibody
    CONFIRM anti-Melanosome (HMB45) Mouse Monoclonal Primary Antibody CONFIRM anti-Melanosome (HMB45) is a mouse monoclonal antibody intended for laboratory use in the qualitative immunohistochemical detection of premelanosome protein (PMEL) by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological exanimation, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostics.
    IVD For in vitro diagnostic use.
    CINtec<sup>®</sup> Histology Kit
    CINtec® Histology Kit Japan
    IVD For in vitro diagnostic use.
    Parathyroid Hormone (PTH) (MRQ-31) Mouse Monoclonal Antibody
    Parathyroid Hormone (PTH) (MRQ-31) Mouse Monoclonal Antibody Parathyroid Hormone (PTH) (MRQ-31) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the parathyroid hormone in formalin-fixed, paraffinembedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    BenchMark ULTRA PLUS
    BenchMark ULTRA PLUS The BenchMark ULTRA PLUS system uses an unprecedented, fully-automated workflow for immunohistochemistry (IHC) and in-situ hybridization (ISH) slide staining to improve turnaround time and decrease touchpoints.
    IVD For in vitro diagnostic use.
    CONFIRM anti-ALK1 (ALK01) Primary Antibody
    CONFIRM anti-ALK1 (ALK01) Primary Antibody CE-IVD This antibody is intended for in vitro diagnostic (IVD) use.Ventana Medical Systems’ (Ventana) CONFIRM anti-ALK1 (ALK01) Primary Antibody is a mouse monoclonal antibody directed against p80 protein present in human tissue. This antibody is intended for laboratory use to qualitatively stain sections of formalin fixed, paraffin embedded tissue on a Ventana automated slide stainer.The clinical interpretation of any staining, or the absence of staining, must be complemented by morphological studies and evaluation of proper controls. Evaluation must be made by a qualified pathologist within the context of the patient’s clinical history and other diagnostic tests. Prescription only.
    IVD For in vitro diagnostic use.
    <i>ultra</i>View SISH DNP Detection Kit
    ultraView SISH DNP Detection Kit US-FDA
    IVD For in vitro diagnostic use.
    CONFIRM anti-MITF (C5/D5) Mouse Monoclonal Primary Antibody
    CONFIRM anti-MITF (C5/D5) Mouse Monoclonal Primary Antibody CONFIRM anti-MITF (C5/D5) Mouse Monoclonal Primary Antibody is a mouse monoclonal antibody cocktail intended for laboratory use in the qualitative immunohistochemical detection of microphthalmia-associated transcription factor (MITF) protein by light microscopy   in sections of formalin-fixed, paraffin-embedded tissue on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CD34 (QBEnd/10) Mouse Monoclonal Antibody
    CD34 (QBEnd/10) Mouse Monoclonal Antibody CD34 (QBEnd/10) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the CD34 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-NSE (MRQ-55) Mouse Monoclonal Primary Antibody
    anti-NSE (MRQ-55) Mouse Monoclonal Primary Antibody NSE (MRQ-55) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the NSE enzyme in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Trichrome Staining Kit
    Trichrome Staining Kit Trichrome Staining Kit is intended for laboratory use as a qualitative histologic stain to demonstrate collagen fibers, muscle and connective tissue by light microscopy in sections of formalin-fixed, paraffin-embedded (FFPE) tissue stained on a BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Diastase Kit
    Diastase Kit Diastase Kit, in conjunction with PAS Staining Kit (860-014 / 05279291001), is intended for use as a digestion reagent to aid in the determination of glycogen in formalin-fixed, paraffin-embedded tissue.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Lysozyme Rabbit Polyclonal Antibody
    Lysozyme Rabbit Polyclonal Antibody Lysozyme Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of lysozyme in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Uroplakin III (SP73) Rabbit Monoclonal Antibody
    Uroplakin III (SP73) Rabbit Monoclonal Antibody Uroplakin III (SP73) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the Uroplakin protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Melanoma Associated Antigen (KBA.62) Mouse Monoclonal Antibody
    Melanoma Associated Antigen (KBA.62) Mouse Monoclonal Antibody Melanoma Associated Antigen (KBA.62) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of an unidentified melanoma associated antigen in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    MUC2 (MRQ-18) Mouse Monoclonal Antibody
    MUC2 (MRQ-18) Mouse Monoclonal Antibody MUC2 (MRQ-18) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the MUC2 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    BenchMark Special Stains AFB Staining Kit
    BenchMark Special Stains AFB Staining Kit The BenchMark Special Stains AFB Staining Kit is intended for laboratory use as a qualitative histologic stain to demonstrate acid-fast bacteria (AFB) by light microscopy in sections of formalinfixed, paraffin-embedded (FFPE) tissue stained on a BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Steiner II Staining Kit
    Steiner II Staining Kit The Steiner II Staining Kit is intended for laboratory use as a qualitative histologic stain to demonstrate argyrophilic microorganisms by light microscopy in sections of formalin-fixed, paraffin-embedded (FFPE) tissue stained on a BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use
    IVD For in vitro diagnostic use.
    Congo Red Staining Kit
    Congo Red Staining Kit Congo Red Staining Kit is intended for laboratory use as a qualitative histologic stain to demonstrate amyloid in sections of formalin-fixed, paraffinembedded (FFPE) tissue stained on a BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CD25 (4C9) Mouse Monoclonal Antibody
    CD25 (4C9) Mouse Monoclonal Antibody CD25 (4C9) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of CD25 in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-PAX-8 (MRQ-50) Mouse Monoclonal Primary Antibody
    anti-PAX-8 (MRQ-50) Mouse Monoclonal Primary Antibody PAX-8 (MRQ-50) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the PAX-8 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    PAS Staining Kit
    PAS Staining Kit The PAS Staining Kit is intended for laboratory use as a qualitative histologic stain to demonstrate the presence of glycogen, basement membrane and fungal organisms by light microscopy in sections of formalin-fixed, paraffin- embedded tissue (FFPE) stained on a BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    PSAP (PASE/4LJ) Mouse Monoclonal Antibody
    PSAP (PASE/4LJ) Mouse Monoclonal Antibody PSAP (PASE/4LJ) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the PSAP protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    PAX8 (EP331) Rabbit Monoclonal Antibody
    PAX8 (EP331) Rabbit Monoclonal Antibody PAX-8 (EP331) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the PAX-8 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-p57<sup>Kip2</sup> (Kp10) Mouse Monoclonal Primary Antibody
    anti-p57Kip2 (Kp10) Mouse Monoclonal Primary Antibody p57Kip2 (Kp10) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the p57Kip2 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-FoxP1 (SP133) Rabbit Monoclonal Primary Antibody
    anti-FoxP1 (SP133) Rabbit Monoclonal Primary Antibody anti-FoxP1 (SP133) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of FoxP1 in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    NKX3.1 (EP356) Rabbit Monoclonal Primary Antibody
    NKX3.1 (EP356) Rabbit Monoclonal Primary Antibody NKX3.1 (EP356) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of NKX3.1 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-TFE3 (MRQ-37) Rabbit Monoclonal Primary Antibody
    anti-TFE3 (MRQ-37) Rabbit Monoclonal Primary Antibody TFE3 (MRQ-37) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the TFE3 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    TdT Rabbit Polyclonal Antibody
    TdT Rabbit Polyclonal Antibody TdT Rabbit Polyclonal Antibody is intended for laboratory use in the detection of TdT in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Desmoglein 3 (5G11) Mouse Monoclonal Primary Antibody
    Desmoglein 3 (5G11) Mouse Monoclonal Primary Antibody Desmoglein 3 (5G11) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the desmoglein 3 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-Desmin (DE-R-11) Primary Antibody
    CONFIRM anti-Desmin (DE-R-11) Primary Antibody CONFIRM anti-Desmin (DE-R-11) is intended for laboratory use in the qualitative immunohistochemical detection of desmin by light microscopy in sections of formalin-fixed, paraffinembedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    E-cadherin (EP700Y) Rabbit Monoclonal Antibody
    E-cadherin (EP700Y) Rabbit Monoclonal Antibody E-cadherin (EP700Y) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the E-cadherin protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-MART-1/melan A (A103) Mouse Monoclonal Primary Antibody
    CONFIRM anti-MART-1/melan A (A103) Mouse Monoclonal Primary Antibody CONFIRM anti-MART-1/melan A (A103) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of melan A by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    MyoD1 (EP212) Rabbit Monoclonal Antibody
    MyoD1 (EP212) Rabbit Monoclonal Antibody MyoD1 (EP212) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the MyoD1 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Mammaglobin (31A5) Rabbit Monoclonal Antibody
    Mammaglobin (31A5) Rabbit Monoclonal Antibody Mammaglobin (31A5) Rabbit Monoclonal Antibody is intended for laboratory use in the detection of the mammaglobin glycoprotein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    SOX-11 (MRQ-58) Mouse Monoclonal Antibody
    SOX-11 (MRQ-58) Mouse Monoclonal Antibody SOX-11 (MRQ-58) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the SOX-11 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    SV40 (MRQ-4) Mouse Monoclonal Antibody
    SV40 (MRQ-4) Mouse Monoclonal Antibody SV40 (MRQ-4) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of Simian Virus 40 (SV40) antigen in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-SOX-2 (SP76) Rabbit Monoclonal Primary Antibody
    anti-SOX-2 (SP76) Rabbit Monoclonal Primary Antibody SOX-2 (SP76) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the SOX-2 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    PD-1 (NAT105) Mouse Monoclonal Antibody
    PD-1 (NAT105) Mouse Monoclonal Antibody PD-1 (NAT105) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the PD-1 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    p21<sup>WAF1</sup> (DCS-60.2) Mouse Monoclonal Antibody
    p21WAF1 (DCS-60.2) Mouse Monoclonal Antibody p21WAF1 (DCS-60.2) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the p21WAF1 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Phosphohistone H3 (PHH3) Rabbit Polyclonal Antibody
    Phosphohistone H3 (PHH3) Rabbit Polyclonal Antibody Phosphohistone H3 (PHH3) Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the Phosphohistone H3 (PHH3) protein in formalin-fixed, paraffinembedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-Prostate Specific Antigen (PSA) Rabbit Polyclonal Primary Antibody
    CONFIRM anti-Prostate Specific Antigen (PSA) Rabbit Polyclonal Primary Antibody CONFIRM anti-Prostate Specific Antigen (PSA) Rabbit Polyclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of PSA by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-Progesterone Receptor (PR) (1E2) Rabbit Monoclonal Primary Antibody
    CONFIRM anti-Progesterone Receptor (PR) (1E2) Rabbit Monoclonal Primary Antibody CONFIRM anti-Progesterone Receptor (PR) (1E2) Rabbit Monoclonal (IgG) Primary Antibody is intended for laboratory use in the qualitative detection of progesterone receptor (PR) antigen in sections of formalin-fixed, paraffin-embedded tissue on a VENTANA automated slide stainer with VENTANA detection kits and ancillary reagents. CONFIRM anti-PR (1E2) is directed against an epitope present on human progesterone receptor protein located in the nucleus of PR positive normal and neoplastic cells.CONFIRM anti-PR (1E2) is indicated as an aid in the management, prognosis, and prediction of hormone therapy for breast carcinoma.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. Prescription use only.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-Pan Keratin (AE1/AE3/PCK26) Primary Antibody
    anti-Pan Keratin (AE1/AE3/PCK26) Primary Antibody Anti-Pan Keratin (AE1/AE3/PCK26) Primary Antibody is an antibody cocktail intended for laboratory use in the qualitative immunohistochemical detection of most acidic cytokeratins and all basic cytokeratins by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    BenchMark ULTRA IHC/ISH System
    BenchMark ULTRA The BenchMark ULTRA IHC instrument is for the pathology professional who values improved quality, reliability and workflow efficiency.
    IVD For in vitro diagnostic use.
    OptiView DAB IHC Detection Kit
    OptiView DAB IHC Detection Kit OptiView DAB IHC Detection Kit (OptiView) is an indirect, biotin-free system for detecting mouse IgG, mouse IgM, and rabbit primary antibodies. The kit is intended to identify targets by immunohistochemistry (IHC) in sections of formalin-fixed, paraffin-embedded and frozen tissue that are stained on the VENTANA automated slide stainers and visualized by light microscopy. The clinical interpretation of any staining, or the absence of staining, must be complemented by morphological studies and evaluation of proper controls.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> anti-PMS2 (A16-4) Mouse Monoclonal Primary Antibody
    VENTANA® anti-PMS2 (A16-4) Mouse Monoclonal Primary Antibody For use with the VENTANA MMR IHC Panel VENTANA anti-PMS2 (A16-4) Mouse Monoclonal Primary Antibody (VENTANA anti-PMS2 (A16-4) antibody) is intended for laboratory use in the qualitative immunohistochemical detection of PMS2 protein in formalin-fixed, paraffin-embedded (FFPE) sections by light microscopy. VENTANA anti-PMS2 (A16-4) antibody is ready to use on a BenchMark IHC/ISH instrument with the OptiView DAB IHC Detection Kit, OptiView Amplification Kit, and ancillary reagents.VENTANA anti-PMS2 (A16-4) antibody is part of the VENTANA MMR RxDx Panel and the VENTANA MMR IHC Panel listed in Table 1.Table 1. Diagnostic Indications for VENTANA MMR Panels.Panel NamePanel Antibodies[a]Clinical ApplicationVENTANA MMR RxDx PanelMLH1, PMS2, MSH2 and MSH6The VENTANA MMR RxDx Panel is indicated as an aid in identifying deficient MMR (dMMR) endometrial carcinoma patients eligible for treatment with JEMPERLI (dostarlimab) in accordance with the approved therapeutic product labelingVENTANA MMR IHC PanelMLH1, PMS2, MSH2, MSH6 and BRAF V600EThe VENTANA MMR IHC Panel is indicated in detection of mismatch repair protein deficiency as a test for the identification of individuals at risk for Lynch syndrome in patients diagnosed with colorectal cancer (CRC), and, with BRAF V600E status, as an aid to differentiate between sporadic and probable Lynch syndrome CRC in the absence of MLH1 protein expression.[a] MLH1- VENTANA anti-MLH1 (M1) Mouse Monoclonal Primary Antibody PMS2- VENTANA anti-PMS2 (A16-4) Mouse Monoclonal Primary Antibody MSH2- VENTANA anti-MSH2 (G219-1129) Mouse Monoclonal Primary Antibody MSH6- VENTANA anti-MSH6 (SP93) Rabbit Monoclonal Primary Antibody BRAF- VENTANA anti-BRAF V600E (VE1) Mouse Monoclonal Primary AntibodyTest results of this panel should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-CMV Blend (8B1.2, 1G5.2 &amp; 2D4.2) Mouse Monoclonal Primary Antibody
    anti-CMV Blend (8B1.2, 1G5.2 & 2D4.2) Mouse Monoclonal Primary Antibody IVD This antibody is intended for in vitro diagnostic (IVD) use.The Cell Marque CMV (8B1.2, 1G5.2 & 2D4.2) antibody is intended for qualified laboratories to qualitatively identify by light microscopy the presence of associated antigens in sections of formalin-fixed, paraffin-embedded tissue sections using IHC test methods. Use of this antibody is indicated, subsequent to clinical differential diagnosis, as an aid in the identification of cytomegalovirus within the context of an antibody panel, the patient’s clinical history, and other diagnostic tests evaluated by a qualified pathologist.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> anti-MLH1 (M1) Mouse Monoclonal Primary Antibody
    VENTANA® anti-MLH1 (M1) Mouse Monoclonal Primary Antibody For use with the VENTANA MMR IHC Panel VENTANA anti-MLH1 (M1) Mouse Monoclonal Primary Antibody (VENTANA anti-MLH1 (M1) antibody) is intended for the qualitative detection of MLH1 protein in formalin-fixed, paraffinembedded tissue sections. VENTANA anti-MLH1 (M1) antibody is ready to use on BenchMark IHC/ISH instruments with the OptiView DAB IHC Detection Kit and ancillary reagents.VENTANA anti-MLH1 (M1) antibody is part of the VENTANA MMR IHC Panel which includes VENTANA anti-PMS2 (A16-4) Mouse Monoclonal Primary Antibody, VENTANA anti-MSH2 (G219- 1129) Mouse Monoclonal Primary Antibody, VENTANA anti-MSH6 (SP93) Rabbit Monoclonal Primary Antibody and VENTANA anti-BRAF V600E (VE1) Mouse Monoclonal Primary Antibody. The VENTANA MMR IHC Panel is indicated for the detection of mismatch repair protein deficiency as a test for the identification of individuals at risk for Lynch syndrome in patients diagnosed with colorectal cancer (CRC), and, with BRAF V600E status, as an aid to differentiate between sporadic and probable Lynch syndrome CRC in the absence of MLH1 protein expression.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> anti-MSH2 (G219-1129) Mouse Monoclonal Primary Antibody
    VENTANA® anti-MSH2 (G219-1129) Mouse Monoclonal Primary Antibody For use with the VENTANA MMR IHC Panel VENTANA anti-MSH2 (G219-1129) Mouse Monoclonal Primary Antibody (VENTANA anti-MSH2 (G219-1129) antibody) is intended for the qualitative detection of MSH2 protein in formalinfixed, paraffin-embedded tissue sections. VENTANA anti-MSH2 (G219- 1129) antibody is ready to use on BenchMark IHC/ISH instruments with the OptiView DAB IHC Detection Kit and ancillary reagents.VENTANA anti-MSH2 (G219-1129) antibody is part of the VENTANA MMR IHC Panel which includes VENTANA anti-MLH1 (M1) Mouse Monoclonal Primary Antibody, VENTANA antiPMS2 (A16-4) Mouse Monoclonal Primary Antibody, VENTANA antiMSH6 (SP93) Rabbit Monoclonal Primary Antibody and VENTANA antiBRAF V600E (VE1) Mouse Monoclonal Primary Antibody. The VENTANA MMR IHC Panel is indicated for the detection of mismatch repair protein deficiency as a test for the identification of individuals at risk for Lynch syndrome in patients diagnosed with colorectal cancer (CRC), and, with BRAF V600E status, as an aid to differentiate between sporadic and probable Lynch syndrome CRC in the absence of MLH1 protein expression.These products should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.Intended for in vitro diagnostic (IVD) use.
    GLU For general laboratory use.
    <b>navify<sup>®</sup></b> Pathology Lab Advantage
    navify® Pathology Lab Advantage The navify® Pathology Lab Advantage solution supports support workflow automation within the anatomical pathology laboratory through:1) Tracking and specimen chain of custody throughout the life of a sample.2) Improved patient safety by reducing errors and minimizing the risk of mislabeling, positive patient identification, and single- piece flow.3) State-of-the-art informatics and business intelligence.4) Promoting productivity and a lean workflow.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY UltraMap anti-Rb HRP
    DISCOVERY UltraMap anti-Rb HRP Biotin-free DAB Detection Systems for the Ventana DISCOVERY Series of Instruments UltraMap anti-Rb is a biotin-free detection systems based on proprietary multimer technology. It consists of a robust chemistry that provides clean background in combination with enhanced specificity and sensitivity, which increases the signal-to-noise ratio. It is designed to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY UltraMap anti-Ms Alk Phos
    DISCOVERY UltraMap anti-Ms Alk Phos Biotin-free DAB Detection Systems for the Ventana DISCOVERY Series of Instruments UltraMap anti-Ms Alk Phos is a biotin-free detection systems based on proprietary multimer technology. It consists of a robust chemistry that provides clean background in combination with enhanced specificity and sensitivity, which increases the signal-to-noise ratio. It is designed to be used in conjunction with the DISCOVERY Series of instruments and VENTANA ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY UltraMap anti-Rb Alk Phos
    DISCOVERY UltraMap anti-Rb Alk Phos Biotin-free DAB Detection Systems for the Ventana DISCOVERY Series of Instruments UltraMap anti-Ms Alk Phos is a biotin-free detection systems based on proprietary multimer technology. It consists of a robust chemistry that provides clean background in combination with enhanced specificity and sensitivity, which increases the signal-to-noise ratio. It is designed to be used in conjunction with the DISCOVERY Series of instruments and VENTANA ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY UltraMap anti-Ms HRP
    DISCOVERY UltraMap anti-Ms HRP Biotin-free DAB Detection Systems for the Ventana DISCOVERY Series of Instruments UltraMap anti-Ms is a biotin-free detection systems based on proprietary multimer technology. It consists of a robust chemistry that provides clean background in combination with enhanced specificity and sensitivity, which increases the signal-to-noise ratio. It is designed to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY OmniMap anti-Rt HRP (RUO)
    DISCOVERY OmniMap anti-Rt HRP (RUO) Biotin-free DAB Detection Systems for the Ventana DISCOVERY Series of Instruments OmniMap anti-Rt HRP is a biotin-free conjugate based on proprietary multimer technology. It consists of a robust chemistry that provides clean background in combination with enhanced specificity and sensitivity, which increases the signal-to-noise ratio. It is designed to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Yellow Kit
    DISCOVERY Yellow Kit DISCOVERY Yellow Kit is a detection kit used for demonstrating the presence of unique antigens in tissues and cells.The DISCOVERY Yellow Kit was designed for antigen localization in frozen sections and/or formalin-fixed, paraffin-embedded tissue sections, to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Purple kit (RUO)
    DISCOVERY Purple kit (RUO) The DISCOVERY Purple Kit was designed for chromogenic antigen localization in frozen sections or formalin-fixed, paraffin-embedded tissue sections, to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ conjugates and ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    mRNA Link (RUO)
    mRNA Link (RUO) mRNA Link is a ready to use ancillary kit for RNAscope® used to quench previously bound HRP which is necessary for assays that target 2 or more mRNA targets. mRNA Link functions without increasing on slide stringency and therefore does not impact hybridized DNA probes.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY RedMap Kit (RUO)
    DISCOVERY RedMap Kit (RUO) Fast Red Detection Kit for the Ventana DISCOVERY Series of Instruments The DISCOVERY RedMap Kit was designed for antigen localization in cytological preparations, frozen sections, or formalin-fixed, paraffin-embedded tissue sections.The RedMap Kit was designed to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY OmniMap anti-Ms HRP (RUO)
    DISCOVERY OmniMap anti-Ms HRP (RUO) Biotin-free DAB Detection Systems for the Ventana DISCOVERY Series of Instruments OmniMap anti-Ms HRP is a biotin-free conjugate based on proprietary multimer technology. It consists of a robust chemistry that provides clean background in combination with enhanced specificity and sensitivity, which increases the signal-to-noise ratio. It is designed to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY mRNA Duplex Amp Kit
    DISCOVERY mRNA Duplex Amp Kit DISCOVERY mRNA Duplex Amp Kit is a user fillable kit to be filled with the appropriate ACD reagents. This kit is to be utilized alongside the corresponding Sample Prep Kit and mRNA detection kits on DISCOVERY staining platforms.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY mRNA RED Probe Amplification Kit
    DISCOVERY mRNA RED Probe Amplification Kit DISCOVERY mRNA RED Probe Amplification Kit is a user fillable kit to be filled with the appropriate ACD reagents. This kit is to be utilized alongside the corresponding mRNA amplification and mRNA detection kits on DISCOVERY staining platforms.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY DAB Map Kit (RUO)
    DISCOVERY DAB Map Kit (RUO) DAB Detection Kit for the Ventana DISCOVERY Series of Instruments The DAB Map Kit was designed for antigen localization in cytological preparations, frozen sections, or formalin-fixed, paraffin-embedded tissue sections.The DAB Map Kit was designed to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY ChromoMap Red Kit (RUO)
    DISCOVERY ChromoMap Red Kit (RUO) Biotin-free Fast Red Detection Kit for the Ventana DISCOVERY Series of Instruments The ChromoMap Red Kit was designed for biotin-free antigen localization in frozen sections or formalin-fixed, paraffin-embedded tissue sections, to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Anti-Prion (99) Research Kit
    DISCOVERY Anti-Prion (99) Research Kit Biotin-free Fast Red Detection Kit for the Ventana DISCOVERY Series of Instruments Anti-Prion ( 99) is a mouse monoclonal antibody derived from hybridoma for use on VENTANA automated slide strainers. The Anti-Prion (99) Research Kit contains the Anti-Prion (99) antibody and detection chemistry required to perform the assay.For Research Use Only. Not for use in diagnostic procedures.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY mRNA Purple HRP Detection Kit
    DISCOVERY mRNA Purple HRP Detection Kit The DISCOVERY mRNA Purple HRP Detection Kit is to be used with a third party Universal HRP Kit. It will enable researchers to stain their mRNA targets of interest with a purple chromogen.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY mRNA Teal HRP Detection Kit
    DISCOVERY mRNA Teal HRP Detection Kit The DISCOVERY mRNA Teal HRP Detection Kit is to be used with a third party Universal HRP. It will enable researchers to stain mRNA targets of interest with a Teal chromogen.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY OmniMap anti-Rb HRP (RUO)
    DISCOVERY OmniMap anti-Rb HRP (RUO) Biotin-free DAB Detection Systems for the Ventana DISCOVERY Series of Instruments OmniMap anti-Rb HRP is a biotin-free conjugate based on proprietary multimer technology. It consists of a robust chemistry that provides clean background in combination with enhanced specificity and sensitivity, which increases the signal-to-noise ratio. It is designed to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ ancillary reagents for optimal performance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY ChromoMap DAB Kit (RUO)
    DISCOVERY ChromoMap DAB Kit (RUO) Biotin-free DAB Detection Kit for the Ventana DISCOVERY Series of Instruments The ChromoMap DAB Kit was designed for chromogenic antigen localization in frozen sections or formalin-fixed, paraffin-embedded tissue sections, to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems’ conjugates and ancillary reagents for optimal performance.
    IVD For in vitro diagnostic use.
    Green for Trichrome
    Green for Trichrome Green for Trichrome, in conjunction with Trichrome Staining Kit, is intended for laboratory use as a qualitative histologic stain to demonstrate collagen fibers, muscle and connective tissue by light microscopy in sections of formalin-fixed, paraffin-embedded (FFPE) tissue stained on a BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Gram Staining Kit
    Gram Staining Kit Gram Staining Kit is intended for use as a qualitative histologic stain to demonstrate gram-negative and gram-positive bacteria in formalin-fixed, paraffin-embedded tissue.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Jones Staining Kit
    Jones Staining Kit The Jones Staining Kit is intended for laboratory use as a qualitative histologic stain to demonstrate capillary basement membranes by light microscopy in sections of formalin-fixed, paraffinembedded (FFPE) tissue stained on the BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Amp HQ Kit
    DISCOVERY Amp HQ Kit The DISCOVERY Amplification HQ Kit isa tyramide based amplification kit designed to be used in conjunction with a DISCOVERY Amplification Anti-HQ Multimer and DISCOVERY HQ Multimer detection kits to allow the detection of lower expressing targets on the DISCOVERY series of instruments.
    IVD For in vitro diagnostic use.
    CONFIRM anti-CD45, LCA (RP2/18) Primary Antibody
    CONFIRM anti-CD45, LCA (RP2/18) Primary Antibody CONFIRM anti-CD45, LCA (RP2/18) Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of CD45 by light microscopy in sections of formalin-fixed, paraffin-embedded tissuestainedon a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-CD43 (L60) Mouse Monoclonal Primary Antibody
    anti-CD43 (L60) Mouse Monoclonal Primary Antibody Anti-CD43 (L60) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of CD43 by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Iron Staining Kit
    Iron Staining Kit The Iron Staining Kit is intended for laboratory use as a qualitative histologic stain to demonstrate iron pigment by light microscopy in sections of formalinfixed, paraffin-embedded (FFPE) tissue stained on a BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Giemsa Staining Kit
    Giemsa Staining Kit The Giemsa Staining Kit is intended for laboratory use as a qualitative histologic stain to demonstrate Helicobacter pylori in the stomach and differentiate hematopoietic cells by light microscopy in sections of formalin-fixed, paraffinembedded (FFPE) tissue stained on BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Jones Light Green Staining Kit
    Jones Light Green Staining Kit The Jones Light Green Staining Kit is intended for laboratory use as a qualitative histologic stain to demonstrate capillary basement membranes by light microscopy in sections of formalin-fixed, paraffinembedded (FFPE) tissue stained on the BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    GMS II Staining Kit
    GMS II Staining Kit GMS II Staining Kit is intended for laboratory use as a qualitative histologic stain to demonstrate polysaccharides in the cell walls of fungal organisms by light microscopy in sections of formalinfixed, paraffin-embedded (FFPE) tissue stained on the BenchMark Special Stains instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> HE 600 Hematoxylin
    VENTANA® HE 600 Hematoxylin VENTANA HE 600 Hematoxylin is intended for use as a qualitative histologic stain to demonstrate nucleic acid staining by light microscopy in sections of formalin-fixed, paraffin-embedded (FFPE) tissue stained on the VENTANA HE 600 system. The product should be interpreted by a qualified pathologist in conjunction with relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> HE 600 Eosin
    VENTANA® HE 600 Eosin VENTANA HE 600 Eosin is intended for use as a qualitative histologic stain to demonstrate cytoplasmic staining by light microscopy in sections of formalin-fixed, paraffin-embedded (FFPE) tissue stained on the VENTANA HE 600 system. The product should be interpreted by a qualified pathologist in conjunction with relevant clinical information, and proper controls. This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-Topoisomerase IIα (JS5B4) Rabbit Monoclonal Primary Antibody
    CONFIRM anti-Topoisomerase IIα (JS5B4) Rabbit Monoclonal Primary Antibody CONFIRM anti-Topoisomerase IIα (JS5B4) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of topoisomerase IIα by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-Tyrosinase (T311) Mouse Monoclonal Primary Antibody
    CONFIRM anti-Tyrosinase (T311) Mouse Monoclonal Primary Antibody CONFIRM anti-Tyrosinase (T311) Mouse Monoclonal Primary Antibody is intended for laboratory use in the qualitative immuno-histochemical detection of tyrosinase by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic use. 
    IVD For in vitro diagnostic use.
    VENTANA<sup>®</sup> anti-MSH6 (SP93) Rabbit Monoclonal Primary Antibody
    VENTANA® anti-MSH6 (SP93) Rabbit Monoclonal Primary Antibody For use with the VENTANA MMR IHC Panel VENTANA anti-MSH6 (SP93) Rabbit Monoclonal Primary Antibody (VENTANA anti-MSH6 (SP93) antibody) is intended for the qualitative detection of MSH6 protein in formalin-fixed, paraffin-embedded tissue sections. VENTANA- anti- MSH6 (SP93) antibody is ready to use on BenchMark ULTRA, XT and GX instruments with the OptiView DAB IHC Detection Kit and ancillary reagents.VENTANA anti-MSH6 (SP93) antibody is part of the VENTANA MMR IHC Panel which includes VENTANA anti-MLH1 (M1) Mouse Monoclonal Primary Antibody, VENTANA anti-PMS2 (A16-4) Mouse Monoclonal Primary Antibody, VENTANA anti-MSH2 (G219-1129) Mouse Monoclonal Primary Antibody and VENTANA anti-BRAF V600E (VE1) Mouse Monoclonal Primary Antibody.The VENTANA MMR IHC Panel is indicated for the detection of mismatch repair protein deficiency as a test for the identification of individuals at risk for Lynch syndrome in patients diagnosed with colorectal cancer (CRC), and, with BRAF V600E status, as an aid to differentiate between sporadic and probable Lynch syndrome CRC in the absence of MLH1 protein expression.These products should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Napsin A Rabbit Polyclonal Antibody
    Napsin A Rabbit Polyclonal Antibody Napsin A Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the Napsin A protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY DCC Kit
    DISCOVERY DCC Kit The DISCOVERY DCC Kit was designed for fluorescent antigen localization in frozen sections or formalin-fixed, paraffin-embedded (FFPE) tissue sections, visualized with a fluorescent microscope. Use in conjunction with the DISCOVERY HRP detection systems including DISCOVERY HQ HRP detection, OmniMap HRP detection, and UltraMap HRP detection kits, DISCOVERY series of instruments, and ancillary reagents for optimal performance. DISCOVERY Inhibitor is required for use with DISCOVERY DCC Kit and should be purchased separately.The following characteristics of the DISCOVERY DCC Kit are provided so that proper microscope settings can be used: Excitation wavelength: 436nm Emission wavelength: 480nmIf the DISCOVERY DCC is to be used in conjunction with other DISCOVERY fluors, it is recommended that a filter with the following specifications be used in order to minimize the amount of bleed through.Excitation: 436/20nmBeamsplitter: 455nmEmission: 480/30nm
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Rhodamine Kit
    DISCOVERY Rhodamine Kit Biotin-free Rhodamine Detection Kit is used with the VENTANA Series of Instruments. This product is intended to be used by researchers wanting to visualize their IHC or ISH results with a fluorescent microscope. The following characteristics of DISCOVERY Rhodamine are provided so that a proper filter can be used: Excitation wavelength: 542nm Emission wavelength 568 nm
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Red 610 Kit
    DISCOVERY Red 610 Kit The DISCOVERY Red 610 Kit was designed for fluorescent antigen localization in frozen sections or formalin-fixed, paraffin-embedded (FFPE) tissue sections, visualized with a fluorescent microscope. Use in conjunction with the DISCOVERY HRP detection systems including DISCOVERY HQ HRP detection, OmniMap HRP detection, and UltraMap HRP detection kits, DISCOVERY series of instruments, and ancillary reagents for optimal performance. DISCOVERY Inhibitor is required for use with DISCOVERY Red 610 Kit and should be purchased separately.The following characteristics of the DISCOVERY Red 610 Kit are provided so that proper microscope settings can be used:Excitation wavelength: 580nm Emission wavelength: 625nmIf the DISCOVERY Red 610 kit is to be used in conjunction with other DISCOVERY fluors, it is recommended that a filter with the following specifications be used in order to minimize the amount of bleed through.Excitation: 580/25nmBeamsplitter: 600nmEmission: 625/30nm
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY mRNA DAB Detection Kit
    DISCOVERY mRNA DAB Detection Kit The DISCOVERY mRNA DAB Detection Kit is to be used with a third party Universal HRP Kit. It will enable researchers to stain their mRNA targets of interest with a DAB chromogen.
    IVD For in vitro diagnostic use.
    IHC Stain Automation – BenchMark GX pathology lab instrument
    BenchMark GX IHC ISH system BenchMark GX is designed for laboratories manually performing immunohistochemistry and/or in situ hybridization, and where consistency, efficiency and quality are of utmost importance.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY FITC Kit (RUO)
    DISCOVERY FITC Kit (RUO) Biotin-free FITC Detection Kit for the Ventana DISCOVERY Series of Instruments (DISCOVERY ULTRA or DISCOVERY XT). This product is intended to be used by researchers wanting to visualize their IHC or ISH results with a fluorescent microscope. The following characteristics of DISCOVERY FITC are provided so that a proper filter can be used:Excitation wavelength: 490nm Emission wavelength 525nm
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Amp BF Kit
    DISCOVERY Amp BF Kit Automated immunohistochemistry (IHC) and in situ hybridization (ISH) are powerful molecular biology techniques for demonstrating the presence of proteins or unique nucleic acid sequences in tissue sections. The DISCOVERY Amp BF Kit is a tyramide based amplification kit designed to be used in conjunction with DISCOVERY Amplification anti-BF multimer, and DISCOVERY multimer detection kits to allow the detection of lower expressing targets on the DISCOVERY series of instruments.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Teal HRP Kit
    DISCOVERY Teal HRP Kit The DISCOVERY Teal HRP Kit is a detection kit used to generate a teal chromogenic signal which can be visualized using a bright field light microscope. The DISCOVERY Teal HRP Kit was designed for chromogenic target localization through IHC or ISH in frozen sections or formalin-fixed, paraffin-embedded tissue sections, to be used in conjunction with the DISCOVERY series of instruments and Ventana Medical Systems conjugates and ancillary reagents for optimal performance.
    IVD For in vitro diagnostic use.
    CONFIRM anti-p53 (DO-7) Primary Antibody
    CONFIRM anti-p53 (DO-7) Primary Antibody CONFIRM anti-p53 (DO-7) Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of p53 protein by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpretedby a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    Country Specific Labeling See country-specific product labeling for regulatory status.
    HHV-8 (13B10) Mouse Monoclonal Antibody
    HHV-8 (13B10) Mouse Monoclonal Antibody HHV-8 Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the HHV-8 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY FAM Kit
    DISCOVERY FAM Kit The DISCOVERY FAM Kit was designed for fluorescent antigen localization in frozen sections or formalin-fixed, paraffin-embedded (FFPE) tissue sections, visualized with a fluorescent microscope. Use in conjunction with the DISCOVERY HRP detection systems including DISCOVERY HQ HRP detection, OmniMap HRP detection, and UltraMap HRP detection kits, DISCOVERY series of instruments, and ancillary reagents for optimal performance. DISCOVERY Inhibitor is required for use with DISCOVERY FAM Kit and should be purchased separately.The following characteristics of the DISCOVERY FAM Kit are provided so that proper microscope settings can be used: Excitation wavelength: 490nm Emission wavelength: 520nmIf the DISCOVERY FAM is to be used in conjunction with other DISCOVERY fluors, it is recommended that a filter with the following specifications be used in order to minimize the amount of bleed through.Excitation: 490/20nmBeamsplitter: 505nmEmission: 520/50nm
    IVD For in vitro diagnostic use.
    Oct-2 (MRQ-2) Mouse Monoclonal Antibody
    Oct-2 (MRQ-2) Mouse Monoclonal Antibody Oct-2 (MRQ-2) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the Oct-2 protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Rhodamine 6G Kit
    DISCOVERY Rhodamine 6G Kit The DISCOVERY Rhodamine 6G Kit was designed for fluorescent antigen localization in frozen sections or formalin-fixed, paraffin-embedded (FFPE) tissue sections, visualized with a fluorescent microscope. Use in conjunction with the DISCOVERY HRP detection systems including DISCOVERY HQ HRP detection, OmniMap HRP detection, and UltraMap HRP detection kits, DISCOVERY series of instruments, and ancillary reagents for optimal performance. DISCOVERY Inhibitor is required for use with DISCOVERY Rhodamine 6G Kit and should be purchased separately.The following characteristics of the DISCOVERY Rhodamine 6G Kit are provided so that proper microscope settings can be used:Excitation wavelength: 546nm Emission wavelength: 572nmIf the DISCOVERY Rhodamine 6G kit is to be used in conjunction with other DISCOVERY fluors, it is recommended that a filter with the following specifications be used in order to minimize the amount of bleed through.Excitation: 546/10nmBeamsplitter: 556nmEmission: 572/23nm
    IVD For in vitro diagnostic use.
    MUC6 (MRQ-20) Mouse Monoclonal Antibody
    MUC6 (MRQ-20) Mouse Monoclonal Antibody MUC6 (MRQ-20) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the MUC6 protein in formalin-fixed, paraffin-embedded tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Calcitonin Rabbit Polyclonal Antibody
    Calcitonin Rabbit Polyclonal Antibody Calcitonin Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the calcitonin hormone in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CONFIRM anti-CD68 (KP-1) Primary Antibody
    CONFIRM anti-CD68 (KP-1) Primary Antibody CONFIRM anti-CD68 (KP-1) Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of CD68 by light microscopy in sections of formalin-fixed, paraffin- embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic use.
    IVD For in vitro diagnostic use.
    Calponin-1 (EP798Y) Rabbit Monoclonal Antibody
    Calponin-1 (EP798Y) Rabbit Monoclonal Antibody Calponin-1 (EP798Y) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the Calponin-1 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    RUO For Research Use Only. Not for use in diagnostic procedures.
    DISCOVERY Cy5 Kit
    DISCOVERY Cy5 Kit The DISCOVERY Cy5 Kit was designed for fluorescent antigen localization in frozen sections or formalin-fixed, paraffin-embedded (FFPE) tissue sections, visualized with a fluorescent microscope. Use in conjunction with the DISCOVERY HRP detection systems including DISCOVERY HQ HRP detection, OmniMap HRP detection, and UltraMap HRP detection kits, DISCOVERY series of instruments, and ancillary reagents for optimal performance. DISCOVERY Inhibitor is required for use with DISCOVERY Cy5 Kit and should be purchased separately.The following characteristics of the DISCOVERY Cy5 Kit are provided so that proper microscope settings can be used:Excitation wavelength: 650nm Emission wavelength 670nm
    IVD For in vitro diagnostic use.
    Glucagon Rabbit Polyclonal Antibody
    Glucagon Rabbit Polyclonal Antibody Glucagon Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the glucagon hormone in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    GH Rabbit Polyclonal Antibody
    GH Rabbit Polyclonal Antibody GH (Growth Hormone) Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the growth hormone in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    ASR Analyte Specific Reagent. Analytical and performance characteristics are not established.
    Lambda DNP Probe (664-693)
    Lambda DNP Probe (664-693) Analyte Specific Reagent. Analytical and performance characteristics are not established.Ventana Medical Systems (Ventana) Lambda DNP Probe (664-693) is designed to bind to Lambda light chain mRNA. The probe sequenced is complementary to the Lambda mRNA sequence: 5’CACAGAAGCUACAGCUGCCAGGUCACGCAU3’.
    IVD For in vitro diagnostic use.
    LH Rabbit Polyclonal Antibody
    LH Rabbit Polyclonal Antibody LH Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the LH glycoprotein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    ASR Analyte Specific Reagent. Analytical and performance characteristics are not established.
    Lambda DNP Probe (704-733)
    Lambda DNP Probe (704-733) Analyte Specific Reagent. Analytical and performance characteristics are not established.Ventana Medical Systems (Ventana) Lambda DNP Probe (704-733) is designed to bind to Lambda light chain mRNA. The probe sequence is complementary to the Lambda mRNA sequence: 5’CCGUGGAGAAGACAGUGGCCCCUACAGAAU3’.
    IVD For in vitro diagnostic use.
    CONFIRM anti-Lambda Rabbit Polyclonal Primary Antibody
    CONFIRM anti-Lambda Rabbit Polyclonal Primary Antibody Polyclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of the Lambda light chain protein by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    ASR Analyte Specific Reagent. Analytical and performance characteristics are not established.
    Lambda DNP Probe (826-855)
    Lambda DNP Probe (826-855) Analyte Specific Reagent. Analytical and performance characteristics are not established.Ventana Medical Systems (Ventana) Lambda DNP Probe (826-855) is designed to bind to Lambda light chain mRNA. The probe is complementary to the Lambda mRNA sequence: 5’GCCCUUCUCCCUGCACUCAAUAAACCCUCA3’.
    ASR Analyte Specific Reagent. Analytical and performance characteristics are not established.
    Lambda DNP Probe (768-797)
    Lambda DNP Probe (768-797) Analyte Specific Reagent. Analytical and performance characteristics are not established.Ventana Medical Systems (Ventana) Lambda DNP Probe (768-797) is designed to bind to Lambda light chain mRNA. The probe sequence is complementary to the Lambda mRNA sequence: 5’GAGACUAGAGCUGCAGGAUCCCAGGGGAGG3’.
    IVD For in vitro diagnostic use.
    Myogenin (F5D) Mouse Monoclonal Antibody
    Myogenin (F5D) Mouse Monoclonal Antibody Myogenin (F5D) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the myogenin protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    SF-1 (EP434) Rabbit Monoclonal Primary Antibody
    SF-1 (EP434) Rabbit Monoclonal Primary Antibody SF-1 (EP434) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the steroidogenic factor-1 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    SATB2 (EP281) Rabbit Monoclonal Antibody
    SATB2 (EP281) Rabbit Monoclonal Antibody SATB2 (EP281) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the SATB2 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    IgM Rabbit Polyclonal Antibody
    IgM Rabbit Polyclonal Antibody IgM Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of IgM in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    IgD Rabbit Polyclonal Antibody
    IgD Rabbit Polyclonal Antibody IgD Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of IgD in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    CA19-9 (121SLE) Mouse Monoclonal Antibody
    CA19-9 (121SLE) Mouse Monoclonal Antibody CA19-9 (121SLE) Mouse Monoclonal Antibody is intended for laboratory use in the detection of the CA19-9 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    INFORM Cytoplasmic Lambda mRNA Probe
    INFORM Cytoplasmic Lambda mRNA Probe INFORM Cytoplasmic Lambda mRNA Probe is intended for laboratory use in the qualitative in situ hybridization-based detection of Lambda light chain mRNA by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    Cytokeratin 19 (A53-B/A2.26) Mouse Monoclonal Antibody
    Cytokeratin 19 (A53-B/A2.26) Mouse Monoclonal Antibody Cytokeratin 19 (A53-B/A2.26) Mouse Monoclonal Antibody is intended for laboratory use in the detection of the Cytokeratin 19 protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    anti-C4d (SP91) Rabbit Monoclonal Primary Antibody
    anti-C4d (SP91) Rabbit Monoclonal Primary Antibody C4d (SP91) Rabbit Monoclonal Primary Antibody is intended for laboratory use in the detection of the C4d protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    C3d Rabbit Polyclonal Antibody
    C3d Rabbit Polyclonal Antibody C3d Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the C3d protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.
    ASR Analyte Specific Reagent. Analytical and performance characteristics are not established.
    Kappa DNP Probe (495-524)
    Kappa DNP Probe (495-524) Ventana Medical Systems (Ventana) Kappa DNP Probe (495-524) is designed to bind to kappa light chain mRNA. The probe sequence is complementary to the Kappa mRNA sequence: 5’UGCCUCUGUUGUGUGCCUGCUGAAUAACUU3’.
    IVD For in vitro diagnostic use.
    CONFIRM anti-Kappa Rabbit Polyclonal Primary Antibody
    CONFIRM anti-Kappa Rabbit Polyclonal Primary Antibody CONFIRM anti-Kappa Rabbit Polyclonal Primary Antibody is intended for laboratory use in the qualitative immunohistochemical detection of the Kappa light chain protein by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information and proper controls.This antibody is intended for in vitro diagnostic (IVD) use.
    ASR Analyte Specific Reagent. Analytical and performance characteristics are not established.
    Kappa DNP Probe (637-666)
    Kappa DNP Probe (637-666) Ventana Medical Systems (Ventana) Kappa DNP Probe (637-666) is designed to bind to kappa light chain mRNA. The probe sequence is complementary to the Kappa mRNA sequence: 5’AGCACCCUGACGCUGAGCAAAGCAGACUAC3’.
    ASR Analyte Specific Reagent. Analytical and performance characteristics are not established.
    Kappa DNP Probe (597-626)
    Kappa DNP Probe (597-626) Ventana Medical Systems (Ventana) Kappa DNP Probe (597-626) is designed to bind to kappa light chain mRNA. The probe sequence is complementary to the Kappa mRNA sequence: 5’CACAGAGCAGGACAGCAAGGACAGCACCUA3’
    ASR Analyte Specific Reagent. Analytical and performance characteristics are not established.
    Kappa DNP Probe (538-567)
    Kappa DNP Probe (538-567) Ventana Medical Systems (Ventana) Kappa DNP Probe (538-567) is designed to bind to kappa light chain mRNA. The probe sequence is complementary to the Kappa mRNA sequence: 5’GCCAAAGUACAGUGGAAGGUGGAUAACGCC3’.
    IVD For in vitro diagnostic use.
    INFORM Kappa Probe
    INFORM Kappa Probe INFORM Kappa Probe is intended for laboratory use in the qualitative in situ hybridization-based detection of Kappa light chain mRNA by light microscopy in sections of formalin-fixed, paraffin-embedded tissue stained on a BenchMark IHC/ISH instrument.This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls.This product is intended for in vitro diagnostic (IVD) use.
    IVD For in vitro diagnostic use.
    PLAP (NB10) Mouse Monoclonal Antibody
    PLAP (NB10) Mouse Monoclonal Antibody PLAP (NB10) Mouse Monoclonal Primary Antibody is intended for laboratory use in the detection of the PLAP protein in formalin-fixed, paraffin-embedded human tissue stained in qualitative immunohistochemistry (IHC) on BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use
    IVD For in vitro diagnostic use.
    Prolactin Rabbit Polyclonal Antibody
    Prolactin Rabbit Polyclonal Antibody Prolactin Rabbit Polyclonal Primary Antibody is intended for laboratory use in the detection of the prolactin protein in formalin-fixed, paraffin-embedded tissue stained on VENTANA BenchMark IHC/ISH instruments. This product should be interpreted by a qualified pathologist in conjunction with histological examination, relevant clinical information, and proper controls. This antibody is intended for in vitro diagnostic (IVD) use.